BBa_K143036 1 XylR Xylose operon regulatory protein 2008-09-15T11:00:00Z 2015-05-08T01:10:24Z The XylR protein was PCR cloned form the ''B. subtilis'' genome using Pfu DNA polymerase Transcription is regulated by proteins which bind operator sequences around the transcription start site. These proteins can positively affect transcription (activators) or negatively affect transcription (reppresors). Some repressor proteins can be inactivted however by addition of an inducer, such as xylose. XylR if the regulator protein for the Xylose operon in ''B. subtilis''<cite>#1</cite> and is responsible for ensuring that in the absence of xylose the xylose metabolism proteins are not expressed. Though endogenous to ''B. subtilis'', to minimise the leakage of a xylose inducible promoter XylR should be over-expressed. In the presence of xylose, the XylR tetramer is unable to bind DNA and so transcription resumes. It must be noted that in all ''B. subtilis'' strains that do not have the Xylose operon knocked out '''the xylose inducer will gradually be metabolised by the host''' XylR was used in conjunction with the '''Xylose operon promoter''' (<bbpart>BBa_K143014<bbpart>) and acted as an input adaptor for a '''Polymerases per second''' (POPS) output false true _199_ 0 3475 9 It's complicated false The XylR protein was identified in the genome using its Genbank entry<cite>#2</cite> and NCBI's sequence viewer and PCR primers designed from the sequence. Biobrick prefix and suffix sequences were added and the gene cloned by PCR with Pfu DNA polymerase false Chris Hirst annotation1975975 1 Xylose operon regulatory protein range1975975 1 1 1050 annotation1992713 1 stop range1992713 1 1054 1056 annotation1992711 1 start range1992711 1 1 3 annotation1992712 1 stop range1992712 1 1051 1053 BBa_K143036_sequence 1 atgactggattaaataaatcaactgtctcatcacaggtaaacacgttaatgaaagaaagtatggtatttgaaataggtcaaggacaatcaagtggcggaagaagacctgtcatgcttgtttttaataaaaaggcaggatactccgttggaatagatgttggtgtggattatattaatggcattttaacagaccttgaaggaacaatcgttcttgatcaataccgccatttggaatccaattctccagaaataacgaaagacattttgattgatatgattcatcactttattacgcaaatgccccaatctccgtacgggtttattggtataggtatttgcgtgcctggactcattgataaagatcaaaaaattgttttcactccgaactccaactggagagatattgacttaaaatcttcgatacaagagaagtacaatgtgtctgtttttattgaaaatgaggcaaatgctggcgcatatggagaaaaactatttggagctgcaaaaaatcacgataacattatttacgtaagtatcagcacaggaatagggatcggtgttattatcaacaatcatttatatagaggagtaagcggcttctctggagaaatgggacatatgacaatagactttaatggtcctaaatgcagttgcggaaaccgaggatgctgggaattgtatgcttcagagaaggctttattaaaatctcttcagaccaaagagaaaaaactgtcctatcaagatatcataaacctcgcccatctgaatgatatcggaaccttaaatgcattacaaaattttggattctatttaggaataggccttaccaatattctaaatactttcaacccacaagccgtaattttaagaaatagcataattgaatcgcatcctatggttttaaattcaatgagaagtgaagtatcatcaagggtttattcccaattaggcaatagctatgaattattgccatcttccttaggacagaatgcaccggcattaggaatgtcctccattgtgattgatcattttctggacatgattacaatgtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z