BBa_K143039 1 SacB-HE SacB-Human Elastin (EP20-24-24) Fusion Protein 2008-09-16T11:00:00Z 2015-05-08T01:10:24Z All exons in EP20-24-24 are derived from the human elastin polypeptide gene. EP20-24-24 was used to study the effect of various combinations of exons on coacervation of elastin polypeptide. SacB was identified from the initial part of certain preprotein genes that utilises the the Sec-SRP secretory pathway <cite>4</cite>. Both components were synthesised as a fusin protein by GeneArt. Elastin is a polymeric extracellular matrix protein found in tissues that require the ability to extend and recoil. Examples of elastin containing tissues include arteries, lungs, ligaments and skin. Construct EP20-24-24 for human elastin polypeptide consists of distinct exons which code for alternating hydrophobic regions and crosslinking domains from the human elastin polypeptide gene <cite>1</cite>. Under appropriate conditions of temperature and ionic strength, elastin polypeptide undergoes a self-aggregation process known as coacervation. Coacervation is usually induced by an increase in temperature and causes the protein to separate from the solution as a second phase. Unlike most proteins which undergo denaturation when the temperature of the solution increases, elastin polypeptides become more ordered through coacervation <cite>2</cite>. SacB is a signal peptide used in the Sec-SRP (secretory signal recognition particle) pathway by ''B. subtilis''. Signal peptides are responsible for directing preproteins (secretory proteins with a signal peptide region attached) through an appropriate secretory pathway. In the case of the Sec-SRP signal peptide, they direct preproteins from the cytoplasm into the growth medium. SacB has been successfully used in the secretion of heterologous proteins such as acid-stable &#945;-amylase, cystatin and interleukin-3 by B.subtilis <cite>3</cite>. false false _199_ 0 3429 9 It's complicated false BioBrick standard was applied to the SacB-Human Elastin(EP20-24-24) Fusion Protein. false Qin Qi annotation1992730 1 stop range1992730 1 697 699 annotation1992729 1 start range1992729 1 1 3 annotation1992732 1 Human Elastin (EP20-24-24) range1992732 1 97 693 annotation1992731 1 stop range1992731 1 694 696 annotation1976019 1 SacB range1976019 1 1 96 BBa_K143039_sequence 1 atgaacatcaaaaaatttgcaaaacaggcgacagttctgacatttacaacagcactgcttgcaggcggcgcaacacaagcatttgcaaaagaaacatttccgggctttggcgttggcgttggaggcattccgggagttgcaggcgttccgggcgttggcggagtcccgggagtcggcggcgttcctggcgtcggcattccggaagcacaagcagcagcagcggcaaaagcagcaaaatatggcgttggcacaccggcagcggcagcagcgaaagcggcagcaaaagcagcgcaatttggcctggttccgggcgtcggagttgcaccgggagttggcgttgcgcctggcgttggagtggctccgggagtgggattagcacctggcgtgggcgtagcaccgggtgtgggagttgctcctggtgtcggcgttgctccggcaattggcccggaagcacaggcggctgcggcagcgaaagctgcgaaatatggtgtcggaacacctgcggcagcggctgcaaaagctgctgcaaaagcggcacagtttggacttgtcccgggagttggagtcgcaccgggcgtaggtgtcgctccgggtgtaggcgtggcaccgggcgttggattagcgccgggagtcggtgtggcacctggtgtcggagtcgcccctggcgttggtgttgcaccggcgattggaccgtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z