BBa_K143013 1 P43 Promoter 43 a constitutive promoter for B. subtilis 2008-09-10T11:00:00Z 2015-05-08T01:10:23Z The part was designed using the sequence from the ''B.subtilis'' genome and from previously published papers <cite>2</cite>. This sequence was then synthesised by Geneart. Promoter 43 is a constitutive promoter that constitutively expresses the P43 protein in ''B.subtilis''. This promoter has been shown to be recognized and active during the exponential and lag phases of growth. It has been hypothesized that the ability to recognize the promoter in exponential and lag phase of growth is due to the recognition of the promoter by both sigma factor 55 (the major sigma factor) and sigma factor 37 (the lag phase sigma factor) <cite>1</cite>. The P43 promoter has been previously used for constitutive expression of exogenous genes within ''B.subtilis'' vectors <cite>2</cite>. The context with which we used the promoter P43 is as a '''Polymerase Per Second''' (PoPS) generator. false false _199_ 0 2090 9 Not in stock false The biobrick part was designed to include the binding sites for both the sigma factor A and B. In addition the biobrick standard was applied to the promoter P43 sequence. false James Chappell annotation1975709 1 Sigma A -10 range1975709 1 47 52 annotation1975707 1 Sigma B -10 range1975707 1 38 47 annotation1975706 1 Sigma B -35 range1975706 1 14 22 annotation1975708 1 Sigma A -35 range1975708 1 24 29 BBa_K143051 1 P43-spoVG Promoter 43 and RBS spoVG for B. subtilis 2008-09-29T11:00:00Z 2015-05-08T01:10:24Z P43-spoVG was synthesised by GeneArt. Constitutive promoter 43(<bbpart>BBa_K143013</bbpart>) coupled to the strong Ribosome Binding Site spoVG(<bbpart>BBa_K143021</bbpart>) from ''B. subtilis''. P43-spoVG can be used in the context of a Polymerase per second (PoPS) output generator. '''To get the highest level of translation from this Promoter-RBS combination it must be connected to a coding region preceded by a coding region prefix<cite>1</cite>. A standard prefix will increase the distance between the RBS and the start codon, reducing translational efficiency.''' false false _199_ 0 3475 9 It's complicated false The sequence of P43 and RBS-spoVG were obtained from papers<cite>1 2</cite> and the sequence synthesised by GeneArt. false Chris Hirst component1977514 1 BBa_K143013 component1977516 1 BBa_K143021 annotation1977514 1 BBa_K143013 range1977514 1 1 56 annotation1977516 1 BBa_K143021 range1977516 1 65 76 BBa_K143021 1 RBS-spoVG SpoVG ribosome binding site (RBS) for B. subtilis 2008-09-16T11:00:00Z 2015-05-08T01:10:23Z The sequence was taken from a previous research paper [1] and was constructed by Geneart. Released HQ 2013 Description: SpoVG is an endogenous ribosome binding site from B.subtilis. The sequence of the spoVG ribosome binding site is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3' region of the 16s rRNA from B.subtilis. Previous research showed that the predicted binding energy of the 16s rRNA to the RBS is -19kcal <cite>1</cite> false true _199_ 0 2090 9 In stock false In order to ensure that the RBS is functional the actual ribosome binding site was maintained and the distance between the RBS and the start codon maintained. In order to conform to the biobrick standard the sequence flanking the RBS had to be changed but the distance between the promoter and RBS, and start codon and RBS was maintained. false James Chappell annotation1975997 1 rbs range1975997 1 1 12 BBa_K143021_sequence 1 aaaggtggtgaa BBa_K143051_sequence 1 attttacatttttagaaatgggcgtgaaaaaaagcgcgcgattatgtaaaatataatactagagaaaggtggtgaa BBa_K143013_sequence 1 attttacatttttagaaatgggcgtgaaaaaaagcgcgcgattatgtaaaatataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z