BBa_K143054 1 Ph-s-gsiB Promoter hyper-spank and RBS gsiB for B. subtilis 2008-10-07T11:00:00Z 2015-05-08T01:10:24Z Phyperspank-gsiB was synthesised by GeneArt Inducible promoter hyper-spank(<bbpart>BBa_K143015</bbpart>) coupled to the strong Ribosome Binding Site gsiB(<bbpart>BBa_K143020</bbpart>) from ''B. subtilis''. Phyperspank-gsiB can be used to take an input of IPTG and give a '''Ribosomes per second''' (RiPS) output generator. IPTG does not directly induce the expression of the promoter hyper-spank, but requires the transcriptional regulator '''LacI''', (<bbpart>BBa_K143035</bbpart>). This means that LacI must be constitutively expressed in ''B.subtilis'' in order to use the promoter hyper-spank as an inducible promoter. '''To get the highest level of translation from this Promoter-RBS combination it must be connected to a coding region preceded by a coding region prefix<cite>1</cite>. A standard prefix will increase the distance between the RBS and the start codon, reducing translational efficiency.''' false false _199_ 0 3475 9 It's complicated false The sequence of promoter hyperspank was obtained from the ''B. subtilis'' integration vector pDR111 and RBS-gsiB were obtained from papers<cite>1</cite> and the sequence synthesised by GeneArt false Chris Hirst component1992686 1 BBa_K143015 component1992688 1 BBa_K143020 annotation1992686 1 BBa_K143015 range1992686 1 1 101 annotation1992688 1 BBa_K143020 range1992688 1 110 120 BBa_K143020 1 RBS-GsiB GsiB ribosome binding site (RBS) for B. subtilis 2008-09-14T11:00:00Z 2015-05-08T01:10:23Z The sequence was taken from a previous research paper [1] and was constructed by Geneart GsiB is an endogenous ribosome binding site from ''B.subtilis''. The sequence of the gsiB ribosome binding site is '''AAAGGAGG''' which is complementary to the sequence '''UUUCCUCC''' from the 3' region of the 16s rRNA from ''B.subtilis''. GsiB is an endogenous ribosome binding site (RBS) from ''B.subtilis''. The sequence of the gsiB ribosome binding site is '''AAAGGAGG''' which is complementary to the sequence '''UUUCCUCC''' from the 3' region of the 16s rRNA from ''B.subtilis''. Previous research showed that the predicted binding energy of the 16s rRNA to the RBS is -9.3kcal. false false _199_ 0 2090 9 Not in stock false In order to ensure that the RBS is functional the actual ribosome binding site was maintained and the distance between the RBS and the start codon maintained. In order to conform to the biobrick standard the sequence flanking the RBS had to be changed but the distance between the promoter and RBS, and start codon and RBS was maintained. false James Chappell annotation1975872 1 rbs range1975872 1 2 8 BBa_K143015 1 Ph-s Promoter hyper-spank for B. subtilis 2008-09-17T11:00:00Z 2015-05-08T01:10:23Z The part was designed using the sequence from the ''B.subtilis'' genome and from previously published papers <cite>1</cite><cite>2</cite><cite>3</cite>. This sequence was then synthesised by Geneart. Promoter hyper-spank is an inducible promoter that has been designed for high expression in ''B.subtilis''. Gene expression under the promoter hyper-spank can be induced by addition of Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG). The context with which we used the promoter hyper-spank, was to take an input of IPTG and give '''Polymerase Per Second'''(PoPS) as an output. IPTG does not induce the promoter hyper-spank directly, but requires the transcriptional regulator '''LacI''', (<bbpart>BBa_K413035</bbpart>). This means that LacI must be constitutively expressed in ''B.subtilis'' in order to use the promoter hyper-spank. false false _199_ 0 3475 9 Not in stock false Biobrick standard was applied to the promoter hyper-spank sequence. false Chris Hirst annotation1976423 1 LacI Operator range1976423 1 10 30 annotation1976424 1 Sigma A -35 range1976424 1 46 50 annotation1976425 1 Sigma A -10 range1976425 1 69 74 annotation1976426 1 LacI Operator range1976426 1 81 101 BBa_K143015_sequence 1 ctcgagggtaaatgtgagcactcacaattcattttgcaaaagttgttgactttatctacaaggtgtggcataatgtgtgtaattgtgagcggataacaatt BBa_K143054_sequence 1 ctcgagggtaaatgtgagcactcacaattcattttgcaaaagttgttgactttatctacaaggtgtggcataatgtgtgtaattgtgagcggataacaatttactagagtaaaggaggaa BBa_K143020_sequence 1 taaaggaggaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z