BBa_K143055 1 Ph-s-spoVG Promoter hyper-spank and RBS spoVG for B. subtilis 2008-10-07T11:00:00Z 2015-05-08T01:10:24Z Phyperspank-spoVG was synthesised by GeneArt Inducible promoter hyper-spank(<bbpart>BBa_K143015</bbpart>) coupled to the strong Ribosome Binding Site spoVG(<bbpart>BBa_K143021</bbpart>) from ''B. subtilis''. Phyperspank-spoVG can be used to take an input of IPTG and give a '''Ribosomes per second''' (RiPS) output generator. IPTG does not directly induce the expression of the promoter hyper-spank, but requires the transcriptional regulator '''LacI''', (<bbpart>BBa_K143033</bbpart>). This means that LacI must be constitutively expressed in ''B.subtilis'' in order to use the promoter hyper-spank as an inducible promoter. '''To get the highest level of translation from this Promoter-RBS combination it must be connected to a coding region preceded by a coding region prefix<cite>1</cite>. A standard prefix will increase the distance between the RBS and the start codon, reducing translational efficiency.''' false false _199_ 0 3475 9 It's complicated false The sequence of promoter hyperspank was obtained from the ''B. subtilis'' integration vector pDR111 and RBS-spoVG were obtained from papers<cite>1</cite> and the sequence synthesised by GeneArt false Chris Hirst component1992693 1 BBa_K143015 component1992695 1 BBa_K143021 annotation1992693 1 BBa_K143015 range1992693 1 1 101 annotation1992695 1 BBa_K143021 range1992695 1 110 121 BBa_K143015 1 Ph-s Promoter hyper-spank for B. subtilis 2008-09-17T11:00:00Z 2015-05-08T01:10:23Z The part was designed using the sequence from the ''B.subtilis'' genome and from previously published papers <cite>1</cite><cite>2</cite><cite>3</cite>. This sequence was then synthesised by Geneart. Promoter hyper-spank is an inducible promoter that has been designed for high expression in ''B.subtilis''. Gene expression under the promoter hyper-spank can be induced by addition of Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG). The context with which we used the promoter hyper-spank, was to take an input of IPTG and give '''Polymerase Per Second'''(PoPS) as an output. IPTG does not induce the promoter hyper-spank directly, but requires the transcriptional regulator '''LacI''', (<bbpart>BBa_K413035</bbpart>). This means that LacI must be constitutively expressed in ''B.subtilis'' in order to use the promoter hyper-spank. false false _199_ 0 3475 9 Not in stock false Biobrick standard was applied to the promoter hyper-spank sequence. false Chris Hirst annotation1976425 1 Sigma A -10 range1976425 1 69 74 annotation1976424 1 Sigma A -35 range1976424 1 46 50 annotation1976423 1 LacI Operator range1976423 1 10 30 annotation1976426 1 LacI Operator range1976426 1 81 101 BBa_K143021 1 RBS-spoVG SpoVG ribosome binding site (RBS) for B. subtilis 2008-09-16T11:00:00Z 2015-05-08T01:10:23Z The sequence was taken from a previous research paper [1] and was constructed by Geneart. Released HQ 2013 Description: SpoVG is an endogenous ribosome binding site from B.subtilis. The sequence of the spoVG ribosome binding site is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3' region of the 16s rRNA from B.subtilis. Previous research showed that the predicted binding energy of the 16s rRNA to the RBS is -19kcal <cite>1</cite> false true _199_ 0 2090 9 In stock false In order to ensure that the RBS is functional the actual ribosome binding site was maintained and the distance between the RBS and the start codon maintained. In order to conform to the biobrick standard the sequence flanking the RBS had to be changed but the distance between the promoter and RBS, and start codon and RBS was maintained. false James Chappell annotation1975997 1 rbs range1975997 1 1 12 BBa_K143021_sequence 1 aaaggtggtgaa BBa_K143015_sequence 1 ctcgagggtaaatgtgagcactcacaattcattttgcaaaagttgttgactttatctacaaggtgtggcataatgtgtgtaattgtgagcggataacaatt BBa_K143055_sequence 1 ctcgagggtaaatgtgagcactcacaattcattttgcaaaagttgttgactttatctacaaggtgtggcataatgtgtgtaattgtgagcggataacaatttactagagaaaggtggtgaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z