BBa_K143021 1 RBS-spoVG SpoVG ribosome binding site (RBS) for B. subtilis 2008-09-16T11:00:00Z 2015-05-08T01:10:23Z The sequence was taken from a previous research paper [1] and was constructed by Geneart. Released HQ 2013 Description: SpoVG is an endogenous ribosome binding site from B.subtilis. The sequence of the spoVG ribosome binding site is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3' region of the 16s rRNA from B.subtilis. Previous research showed that the predicted binding energy of the 16s rRNA to the RBS is -19kcal <cite>1</cite> false true _199_ 0 2090 9 In stock false In order to ensure that the RBS is functional the actual ribosome binding site was maintained and the distance between the RBS and the start codon maintained. In order to conform to the biobrick standard the sequence flanking the RBS had to be changed but the distance between the promoter and RBS, and start codon and RBS was maintained. false James Chappell annotation1975997 1 rbs range1975997 1 1 12 BBa_K143057 1 Pxyl-spoVG Promoter xyl and RBS spoVG for B subtilis 2008-10-05T11:00:00Z 2015-05-08T01:10:24Z Pxyl-spoVG was synthesised by GeneArt Inducible promoter xyl(<bbpart>BBa_K143014</bbpart>) coupled to the strong Ribosome Binding Site spoVG(<bbpart>BBa_K143021</bbpart>) from ''B. subtilis''. Pxyl-spoVG can be used to take an input of xylose and give a '''Ribosomes per second''' (RiPS) output generator. Xylose does not directly induce the expression of the promoter xyl, but requires the transcriptional regulator '''XylR''', (<bbpart>BBa_K143036</bbpart>). This means that XylR must be constitutively expressed in ''B.subtilis'' in order to use the promoter hyper-spank as an inducible promoter. XylR is naturally expressed by ''B. subtilis'' but should be upregulated to increase efficiency. '''To get the highest level of translation from this Promoter-RBS combination it must be connected to a coding region preceded by a coding region prefix<cite>1</cite>. A standard prefix will increase the distance between the RBS and the start codon, reducing translational efficiency.''' false false _199_ 0 3475 9 It's complicated false The sequence of promoter xyl and RBS-spoVG were obtained from papers<cite>1 2 3</cite> and the sequence synthesised by GeneArt false Chris Hirst component1978552 1 BBa_K143014 component1978554 1 BBa_K143021 annotation1978554 1 BBa_K143021 range1978554 1 91 102 annotation1978552 1 BBa_K143014 range1978552 1 1 82 BBa_K143014 1 Pxyl Promoter Xyl for B.subtilis 2008-09-14T11:00:00Z 2015-05-08T01:10:23Z The part was designed using the sequence from the ''B.subtilis'' genome and from previously published papers <cite>1</cite><cite>2</cite>. This sequence was then synthesised by Geneart. Promoter Xylose is an inducible promoter that has been designed for high expression in ''B.subtilis''. Gene expression under the promoter xylose can be induced by addition of xylose. The context with which we used the promoter xylose, was to take an input of xylose and give '''Polymerase Per Second'''(PoPS) as an output.<br> Promoter xylose is an inducible promoter that has been designed for high expression in ''B.subtilis''. Gene expression under the promoter xylose can be induced by addition of xylose. The context with which we used the promoter xylose, was to take an input of xylose and give '''Polymerase Per Second'''(PoPS) as an output. Xylose does not induce the promoter xylose directly, but requires the transcriptional regulator '''XylR''', (<bbpart>BBa_K143036</bbpart>) This means that XylR must be constitutively expressed in ''B.subtilis'' in order to use the promoter xylose. false false _199_ 0 2090 9 Not in stock false Biobrick standard was applied to the promoter xylose sequence. false James Chappell annotation1976429 1 Sigma A -10 range1976429 1 36 41 annotation1975869 1 XylR Operator range1975869 1 65 75 annotation1976428 1 Sigma A -35 range1976428 1 13 18 annotation1975868 1 XylR Operator range1975868 1 51 61 BBa_K143014_sequence 1 ctaaaaaaaatattgaaaatactgacgaggttatataagatgaaaataagttagtttgtttaaacaacaaactaataggtga BBa_K143021_sequence 1 aaaggtggtgaa BBa_K143057_sequence 1 ctaaaaaaaatattgaaaatactgacgaggttatataagatgaaaataagttagtttgtttaaacaacaaactaataggtgatactagagaaaggtggtgaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z