BBa_K143059 1 Pctc-spoVG Promoter ctc and RBS spoVG for B. subtilis 2008-10-05T11:00:00Z 2015-05-08T01:10:24Z The sequence of promoter ctc was obtained from the ''B. subtilis'' genome and published papers<cite>1 2</cite>. RBS-spoVG were obtained from papers<cite>3</cite> and the sequence synthesised by GeneArt Sigma B dependant promoter ctc(<bbpart>BBa_K143010</bbpart>) coupled to the strong Ribosome Binding Site spoVG(<bbpart>BBa_K143021</bbpart>) from ''B. subtilis''. In ''B. subtilis'' endogenous sigma factor B is activated under mild stress. These mild stress conditions can be generally split into nutrient stress response and physical stress response. Nutrient stress response is triggered by low levels of ATP and GTP and physical stress response is triggered by exposure to blue light, salt, heat, acid or ethanol<cite>1</cite>. The promoter ctc has been used previously as a read out for the activation of sigma factor B <cite>2</cite>. Pctc has been used to take an input of blue light and give a '''Ribosomes per second'''(RiPS) output. To work as a blue light receiver correctly, over-expression of the blue light receptor '''YtvA''' (<bbpart>BBa_K143037</bbpart>) is required. '''To get the highest level of translation from this Promoter-RBS combination it must be connected to a coding region preceded by a coding region prefix<cite>1</cite>. A standard prefix will increase the distance between the RBS and the start codon, reducing translational efficiency.''' false false _199_ 0 3475 9 It's complicated false Pctc-spoVG was synthesised by GeneArt false Chris Hirst component1978542 1 BBa_K143021 component1978540 1 BBa_K143010 annotation1978540 1 BBa_K143010 range1978540 1 1 56 annotation1978542 1 BBa_K143021 range1978542 1 65 76 BBa_K143010 1 Pctc Promoter ctc for B. subtilis 2008-09-10T11:00:00Z 2015-05-08T01:10:23Z The part was designed using the sequence from the ''B.subtilis'' genome and from previously published papers <cite>2</cite><cite>3</cite>. This sequence was then synthesised by Geneart. Promoter ctc is a sigma factor B dependent promoter found in ''B.subtilis''. In ''B.subtilis'' endogenous sigma factor B is activated under mild stress. These mild stress conditions can be generally split into nutrient stress response and physical stress response. Nutrient stress response is triggered by low levels of ATP and GTP and physical stress response is triggered by exposure to blue light, salt, heat, acid or ethanol<cite>1</cite>. The promoter ctc has been used previously as a read out for the activation of sigma factor B <cite>2</cite>. *The context with which we used the promoter ctc, was to take blue light as an input and give '''Polymerase Per Second'''(PoPS) as an output. To do this the other potential inputs need to be carefully controlled so that only blue light activated the sigma B and gives a PoPS output. In order to get sufficient sigma B activation by blue light the light receptor YtvA, part...., needs to be over expressed in ''B.subtilis'' <cite>3</cite>. ===Reference=== <biblio> #1 pmid=16267279 #2 pmid=3100810 #3 pmid=17575448 </biblio> false false _199_ 0 2090 9 Not in stock false Biobrick standard was applied to the promoter ctc sequence. false James Chappell annotation1975701 1 Sigma B -35 range1975701 1 21 28 annotation1975700 1 Sigma B -10 range1975700 1 41 46 BBa_K143021 1 RBS-spoVG SpoVG ribosome binding site (RBS) for B. subtilis 2008-09-16T11:00:00Z 2015-05-08T01:10:23Z The sequence was taken from a previous research paper [1] and was constructed by Geneart. Released HQ 2013 Description: SpoVG is an endogenous ribosome binding site from B.subtilis. The sequence of the spoVG ribosome binding site is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3' region of the 16s rRNA from B.subtilis. Previous research showed that the predicted binding energy of the 16s rRNA to the RBS is -19kcal <cite>1</cite> false true _199_ 0 2090 9 In stock false In order to ensure that the RBS is functional the actual ribosome binding site was maintained and the distance between the RBS and the start codon maintained. In order to conform to the biobrick standard the sequence flanking the RBS had to be changed but the distance between the promoter and RBS, and start codon and RBS was maintained. false James Chappell annotation1975997 1 rbs range1975997 1 1 12 BBa_K143059_sequence 1 cagctaaaccatttttcgaggtttaaatccttatcgttatgggtattgtttgtaattactagagaaaggtggtgaa BBa_K143021_sequence 1 aaaggtggtgaa BBa_K143010_sequence 1 cagctaaaccatttttcgaggtttaaatccttatcgttatgggtattgtttgtaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z