BBa_K143033 1 LacI LacI (Lva^-, N-terminal deletion) regulatory protein 2008-09-15T11:00:00Z 2015-05-08T01:10:24Z The LacI gene was cloned from''B. subtilis'' shuttle vector pDR111 using Pfu DNA polymerase PCR LacI is a regulatory protein responsible for the repression of many catabolite genes. Transcription is regulated by proteins which bind operator sequences around the transcription start site. These proteins can positively affect transcription (activators) or negatively affect transcription (reppresors). Some repressor proteins can be inactivted however by addition of an inducer, such as IPTG or certain sugars. LacI if the regulator protein for the lactose operon in ''E.coli'' and the hyper-spank protein of ''B. subtilis''<cite>#1</cite>(<bbpart>BBaK143015</bbpart>) and is responsible for ensuring that in the absence of lactose (or IPTG) that there is no expression trough these promoter. LacI is not endogenous to ''B. subtilis'', so LacI will need to be expressed in the host in order for the hyper-spank promoter to be regulated. In the presence of IPTG or lactose, the LacI tetramer is unable to bind DNA and so transcription resumes. This version of LacI lacks a Lva degradation tag and has a small(3 amino acid) N-terminal deletion relative to the current registry LacI (<bbpart>BBa_C0012</bbpart)> and is derivatives. The N-terminal deletion appears to be common to most of the LacI genes used in conjunction with ''B. subtilis'' though both forms are found in ''E.coli'' (in differing strains). LacI was used in conjunction with the '''Hyper-spank promoter''' (<bbpart>BBa_K143015<bbpart>) and acted as an input adaptor for a '''Polymerases per second''' (POPS) output ====References==== <biblio> #1 pmid=16166525 </biblio> false false _199_ 0 3475 9 It's complicated false LacI was located in the sequence of the ''B. subtilis'' shuttle vector pDR111. This version of LacI lacks a Ltva degradation sequence and has a small N-terminal deletion that is observed in many LacI used in studies on ''B.subtilis''. In particular, this LacI protein is used in pDR111 to regulate expression of the inducible Phyper-spank protein (<bbpart>BBa_K143015</bbpart>) (also used in the pDR111 vector). The BioBrick prefix and suffix were applied to the gene false Chris Hirst annotation1994271 1 stop range1994271 1 1081 1083 annotation1992702 1 start range1992702 1 1 3 annotation1994272 1 stop range1994272 1 1084 1086 annotation1975974 1 LacI (Lva-, N-terminal deletion) regulatory protein range1975974 1 1 1080 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K143062 1 LacI-T LacI repressor protein - Terminator 2008-09-30T11:00:00Z 2015-05-08T01:10:24Z LacI was produced by PCR cloning using Pfu form the ''B. subtilis'' integration vector and cloned into a BioBrick with the registry double terminator. LacI transcriptional repressor protein (<bbpart>BBa_K143033</bbpart>) coupled to the double terminator (<bbpart>BBa_B0015</bbpart>. The LacI does not possess a LVA degradation tag and gas a short (3 amino acid) N-terminal deletion consistent with LacI used in conjunction with ''B. subtilis''. LacI can be used in conjunction with the lac operon promoter (<bbpart>BBa_K143015</bbpart>), where the LacI will act as a receiver for an IPTG input to result in a '''Polymerases per second''' (PoPS) output. The double terminator is the most commonly used terminator and is a combination of parts <bbpart>BBa_B0010</bbpart> and <bbpart>BBa_B0012</bbpart>. The double terminator allows the LacI to be easily incorporated into a closed transcriptional unit. false false _199_ 0 3475 9 It's complicated false LacI was identified from the pDR111 ''B. subtilis'' integration vector. The double terminator is the most commonly used registry terminator. false Chris Hirst component1994509 1 BBa_K143033 component1994512 1 BBa_B0012 component1994510 1 BBa_B0010 annotation1994512 1 BBa_B0012 range1994512 1 1183 1223 annotation1994510 1 BBa_B0010 range1994510 1 1095 1174 annotation1994509 1 BBa_K143033 range1994509 1 1 1086 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K143062_sequence 1 atgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaaacggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgtcaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K143033_sequence 1 atgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaaacggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgtcaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z