BBa_K143063 1 XylR-T Xylose operon repressor protein - Terminator 2008-10-08T11:00:00Z 2015-05-08T01:10:24Z XylR was produced by PCR cloning using Pfu form the ''B. subtilis'' chromosome and cloned into a BioBrick with the registry double terminator Xylose operon repressor protein(XylR)(<bbpart>BBa_K143036</bbpart>) coupled to the double terminator (<bbpart>BBa_B0015</bbpart>. XylR can be used in conjunction with the xylose operon promoter (<bbpart>BBa_K143014</bbpart>), where the XylR will act as a receiver for a xylose input to result in a '''Polymerases per second''' (PoPS) output. The double terminator is the most commonly used terminator and is a combination of parts <bbpart>BBa_B0010</bbpart> and <bbpart>BBa_B0012</bbpart>. The double terminator allows the XylR to be easily incorporated into a closed transcriptional unit. false false _199_ 0 3475 9 Not in stock false XylR was identified from the ''B. subtilis'' chromosome. The double terminator is the most commonly used registry terminator. false Chris Hirst component1980011 1 BBa_K143036 component1980014 1 BBa_B0012 component1980012 1 BBa_B0010 annotation1980011 1 BBa_K143036 range1980011 1 1 1056 annotation1980012 1 BBa_B0010 range1980012 1 1065 1144 annotation1980014 1 BBa_B0012 range1980014 1 1153 1193 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K143036 1 XylR Xylose operon regulatory protein 2008-09-15T11:00:00Z 2015-05-08T01:10:24Z The XylR protein was PCR cloned form the ''B. subtilis'' genome using Pfu DNA polymerase Transcription is regulated by proteins which bind operator sequences around the transcription start site. These proteins can positively affect transcription (activators) or negatively affect transcription (reppresors). Some repressor proteins can be inactivted however by addition of an inducer, such as xylose. XylR if the regulator protein for the Xylose operon in ''B. subtilis''<cite>#1</cite> and is responsible for ensuring that in the absence of xylose the xylose metabolism proteins are not expressed. Though endogenous to ''B. subtilis'', to minimise the leakage of a xylose inducible promoter XylR should be over-expressed. In the presence of xylose, the XylR tetramer is unable to bind DNA and so transcription resumes. It must be noted that in all ''B. subtilis'' strains that do not have the Xylose operon knocked out '''the xylose inducer will gradually be metabolised by the host''' XylR was used in conjunction with the '''Xylose operon promoter''' (<bbpart>BBa_K143014<bbpart>) and acted as an input adaptor for a '''Polymerases per second''' (POPS) output false true _199_ 0 3475 9 It's complicated false The XylR protein was identified in the genome using its Genbank entry<cite>#2</cite> and NCBI's sequence viewer and PCR primers designed from the sequence. Biobrick prefix and suffix sequences were added and the gene cloned by PCR with Pfu DNA polymerase false Chris Hirst annotation1992713 1 stop range1992713 1 1054 1056 annotation1992712 1 stop range1992712 1 1051 1053 annotation1992711 1 start range1992711 1 1 3 annotation1975975 1 Xylose operon regulatory protein range1975975 1 1 1050 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K143063_sequence 1 atgactggattaaataaatcaactgtctcatcacaggtaaacacgttaatgaaagaaagtatggtatttgaaataggtcaaggacaatcaagtggcggaagaagacctgtcatgcttgtttttaataaaaaggcaggatactccgttggaatagatgttggtgtggattatattaatggcattttaacagaccttgaaggaacaatcgttcttgatcaataccgccatttggaatccaattctccagaaataacgaaagacattttgattgatatgattcatcactttattacgcaaatgccccaatctccgtacgggtttattggtataggtatttgcgtgcctggactcattgataaagatcaaaaaattgttttcactccgaactccaactggagagatattgacttaaaatcttcgatacaagagaagtacaatgtgtctgtttttattgaaaatgaggcaaatgctggcgcatatggagaaaaactatttggagctgcaaaaaatcacgataacattatttacgtaagtatcagcacaggaatagggatcggtgttattatcaacaatcatttatatagaggagtaagcggcttctctggagaaatgggacatatgacaatagactttaatggtcctaaatgcagttgcggaaaccgaggatgctgggaattgtatgcttcagagaaggctttattaaaatctcttcagaccaaagagaaaaaactgtcctatcaagatatcataaacctcgcccatctgaatgatatcggaaccttaaatgcattacaaaattttggattctatttaggaataggccttaccaatattctaaatactttcaacccacaagccgtaattttaagaaatagcataattgaatcgcatcctatggttttaaattcaatgagaagtgaagtatcatcaagggtttattcccaattaggcaatagctatgaattattgccatcttccttaggacagaatgcaccggcattaggaatgtcctccattgtgattgatcattttctggacatgattacaatgtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K143036_sequence 1 atgactggattaaataaatcaactgtctcatcacaggtaaacacgttaatgaaagaaagtatggtatttgaaataggtcaaggacaatcaagtggcggaagaagacctgtcatgcttgtttttaataaaaaggcaggatactccgttggaatagatgttggtgtggattatattaatggcattttaacagaccttgaaggaacaatcgttcttgatcaataccgccatttggaatccaattctccagaaataacgaaagacattttgattgatatgattcatcactttattacgcaaatgccccaatctccgtacgggtttattggtataggtatttgcgtgcctggactcattgataaagatcaaaaaattgttttcactccgaactccaactggagagatattgacttaaaatcttcgatacaagagaagtacaatgtgtctgtttttattgaaaatgaggcaaatgctggcgcatatggagaaaaactatttggagctgcaaaaaatcacgataacattatttacgtaagtatcagcacaggaatagggatcggtgttattatcaacaatcatttatatagaggagtaagcggcttctctggagaaatgggacatatgacaatagactttaatggtcctaaatgcagttgcggaaaccgaggatgctgggaattgtatgcttcagagaaggctttattaaaatctcttcagaccaaagagaaaaaactgtcctatcaagatatcataaacctcgcccatctgaatgatatcggaaccttaaatgcattacaaaattttggattctatttaggaataggccttaccaatattctaaatactttcaacccacaagccgtaattttaagaaatagcataattgaatcgcatcctatggttttaaattcaatgagaagtgaagtatcatcaagggtttattcccaattaggcaatagctatgaattattgccatcttccttaggacagaatgcaccggcattaggaatgtcctccattgtgattgatcattttctggacatgattacaatgtaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z