BBa_K143064 1 CmR-T Chloramphenicol resistance protein - Terminator 2008-10-08T11:00:00Z 2015-05-08T01:10:24Z The Chloraphemicol acetyltransferase and double terminator were taken both taken from the registry. Chloraphemicol acetyltransferase protein(<bbpart>BBa_J31005</bbpart>) coupled to the double terminator (<bbpart>BBa_B0015</bbpart>). Chloraphemicol acetyltransferase confers resistance to Chloraphemicol. The double terminator is the most commonly used terminator and is a combination of parts <bbpart>BBa_B0010</bbpart> and <bbpart>BBa_B0012</bbpart>. The double terminator allows the CAT to be incorporated into a closed transcriptional unit. false true _199_ 0 3475 9 It's complicated true Chloraphemicol acetyltransferase is an exisiting registry protein. The double terminator is the most commonly used registry termiantor. true Chris Hirst component1980004 1 BBa_B0010 component1980003 1 BBa_J31005 component1980006 1 BBa_B0012 annotation1980006 1 BBa_B0012 range1980006 1 757 797 annotation1980003 1 BBa_J31005 range1980003 1 1 660 annotation1980004 1 BBa_B0010 range1980004 1 669 748 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_J31005 1 CmR chloramphenicol acetyltransferase (forwards, CmF) [cf. BBa_J31004] 2006-07-11T11:00:00Z 2015-08-31T04:08:45Z pSB1AC3 When a promoter and an RBS are in front of the gene, the cell will express Chloramphenicol resistance. Because it contains full biobrick ends, this part can be used to easily add chloramphenicol resistance to any part without changing plasmid vectors. false true _61_ 0 918 61 In stock true This part is cloned into pSB1A2. true Erin Zwack, Sabriya Rosemond annotation1884999 1 CmR gene range1884999 1 1 660 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K143064_sequence 1 atggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaatttcgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtttgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J31005_sequence 1 atggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaatttcgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtttgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z