BBa_K143031 1 Aad9 Aad9 Spectinomycin Resistance Gene 2008-09-15T11:00:00Z 2015-05-08T01:10:24Z Aad9 was PCR cloned from the ''B. subtilis'' integration vector pDR111 using Pfu DNA polymerase Aad9 is the spectinomycin resistance gene from ''Enterococcus faecalis''<cite>#1</cite>. Expression in a host confers resistance to spectinomycin at a concentration of 100&#956;g/&#956;l and has been used in a variety of vectors for both ''B. subtilis'' and ''E. coli'' including pDP870<cite>#2</cite>, pCOMT-Kan<cite>#3</cite> and pIEF16s<cite>#4</cite> ====References==== <biblio> #1 pmid=1659306 #2 pmid=16997985 #3 pmid=15060042 #4 pmid=16714443 </biblio> false false _199_ 0 3475 9 It's complicated false The sequence of ''B. subtilis'' integration vector pDR111 was searched for the spectinomycin resistance gene and the Biobrick standard applied to the gene sequence upon PCR cloning false Chris Hirst annotation1992697 1 stop range1992697 1 769 771 annotation1992696 1 stop range1992696 1 766 768 annotation1975961 1 Aad9 Spectinomycin Acetyltransferase range1975961 1 1 765 annotation1992698 1 start range1992698 1 1 3 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K143065 1 Aad9-T Spectinomycin Resistance Protein (Aad9) - Terminator 2008-10-08T11:00:00Z 2015-05-08T01:10:24Z Aad9 was PCR cloned from the ''B. subtilis'' integration vector utilising Pfu DNA polymerase and cloned into a BioBrick iwth the double terminator was taken from the registry Aad9 spectinomycin resistance protein(<bbpart>BBa_K143031</bbpart>) coupled to the double terminator (<bbpart>BBa_B0015</bbpart>). Aad9 confers resistance to spectinomycin. The double terminator is the most commonly used terminator and is a combination of parts <bbpart>BBa_B0010</bbpart> and <bbpart>BBa_B0012</bbpart>. The double terminator allows the Spectinomycin resistance gene to be incorporated into a closed transcriptional unit. false false _199_ 0 3475 9 It's complicated false Aad9 was PCR cloned from the ''B. subtilis'' integration vector utilising Pfu DNA polymerase. The double terminator is the most commonly used registry termiantor. false Chris Hirst and Imperial iGEM 08 component1985266 1 BBa_B0010 component1985265 1 BBa_K143031 component1985268 1 BBa_B0012 annotation1985268 1 BBa_B0012 range1985268 1 868 908 annotation1985266 1 BBa_B0010 range1985266 1 780 859 annotation1985265 1 BBa_K143031 range1985265 1 1 771 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K143065_sequence 1 atgaggaggatatatttgaatacatacgaacaaattaataaagtgaaaaaaatacttcggaaacatttaaaaaataaccttattggtacttacatgtttggatcaggagttgagagtggactaaaaccaaatagtgatcttgactttttagtcgtcgtatctgaaccattgacagatcaaagtaaagaaatacttatacaaaaaattagacctatttcaaaaaaaataggagataaaagcaacttacgatatattgaattaacaattattattcagcaagaaatggtaccgtggaatcatcctcccaaacaagaatttatttatggagaatggttacaagagctttatgaacaaggatacattcctcagaaggaattaaattcagatttaaccataatgctttaccaagcaaaacgaaaaaataaaagaatatacggaaattatgacttagaggaattactacctgatattccattttctgatgtgagaagagccattatggattcgtcagaggaattaatagataattatcaggatgatgaaaccaactctatattaactttatgccgtatgattttaactatggacacgggtaaaatcataccaaaagatattgcgggaaatgcagtggctgaatcttctccattagaacatagggagagaattttgttagcagttcgtagttatcttggagagaatattgaatggactaatgaaaatgtaaatttaactataaactatttaaataacagattaaaaaaattataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K143031_sequence 1 atgaggaggatatatttgaatacatacgaacaaattaataaagtgaaaaaaatacttcggaaacatttaaaaaataaccttattggtacttacatgtttggatcaggagttgagagtggactaaaaccaaatagtgatcttgactttttagtcgtcgtatctgaaccattgacagatcaaagtaaagaaatacttatacaaaaaattagacctatttcaaaaaaaataggagataaaagcaacttacgatatattgaattaacaattattattcagcaagaaatggtaccgtggaatcatcctcccaaacaagaatttatttatggagaatggttacaagagctttatgaacaaggatacattcctcagaaggaattaaattcagatttaaccataatgctttaccaagcaaaacgaaaaaataaaagaatatacggaaattatgacttagaggaattactacctgatattccattttctgatgtgagaagagccattatggattcgtcagaggaattaatagataattatcaggatgatgaaaccaactctatattaactttatgccgtatgattttaactatggacacgggtaaaatcataccaaaagatattgcgggaaatgcagtggctgaatcttctccattagaacatagggagagaattttgttagcagttcgtagttatcttggagagaatattgaatggactaatgaaaatgtaaatttaactataaactatttaaataacagattaaaaaaattataataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z