BBa_K143013 1 P43 Promoter 43 a constitutive promoter for B. subtilis 2008-09-10T11:00:00Z 2015-05-08T01:10:23Z The part was designed using the sequence from the ''B.subtilis'' genome and from previously published papers <cite>2</cite>. This sequence was then synthesised by Geneart. Promoter 43 is a constitutive promoter that constitutively expresses the P43 protein in ''B.subtilis''. This promoter has been shown to be recognized and active during the exponential and lag phases of growth. It has been hypothesized that the ability to recognize the promoter in exponential and lag phase of growth is due to the recognition of the promoter by both sigma factor 55 (the major sigma factor) and sigma factor 37 (the lag phase sigma factor) <cite>1</cite>. The P43 promoter has been previously used for constitutive expression of exogenous genes within ''B.subtilis'' vectors <cite>2</cite>. The context with which we used the promoter P43 is as a '''Polymerase Per Second''' (PoPS) generator. false false _199_ 0 2090 9 Not in stock false The biobrick part was designed to include the binding sites for both the sigma factor A and B. In addition the biobrick standard was applied to the promoter P43 sequence. false James Chappell annotation1975706 1 Sigma B -35 range1975706 1 14 22 annotation1975707 1 Sigma B -10 range1975707 1 38 47 annotation1975708 1 Sigma A -35 range1975708 1 24 29 annotation1975709 1 Sigma A -10 range1975709 1 47 52 BBa_K143001 1 amyE 5 IS 5??? Integration Sequence for the amyE locus of B. subtilis 2008-08-26T11:00:00Z 2015-05-08T01:10:23Z The 5??? integration sequence was taken from the shuttle vector pDR111 which has been used in many studies on ''B.subtilis'', in particular in the studies of transcriptional control<cite>#1 #2 #3</cite> <biblio> #1 pmid=14597697 #2 pmid=15937167 #3 pmid=12169614 </biblio> Released HQ 2013 The 5' integration sequence can be added to the front of a Biobrick construct and the 3' integration sequence specific for this locus (Part BBa_K143002) to the rear of the Biobrick construct to allow integration of the Biobrick construct into the chromosome of the gram positive bacterium B.subtilis. The AmyE locus was the first locus used for integration into ''B.subtilis'' by Shimotsu and Henner<cite>#1</cite> and is still commonly used in vectors such as pDR111<cite>#2</cite>, pDL<cite>#3</cite> and their derivatives. Integration at the AmyE locus removes the ability of ''B.subtilis'' to break down starch, which can be assayed with iodine as described by Cutting and Vander-horn<cite>#4</cite>. The 5' and 3' integration sequences for the AmyE locus were used to integrate the Imperial 2008 iGEM project primary construct into the ''B.sutbilis'' chromosome. <biblio> #1 pmid=3019840 #2 pmid=14597697 #3 ''Bacillus'' Genetic Stock Center [www.bgsc.org] #4 Cutting, S M.; Vander-Horn, P B. Genetic analysis. In: Harwood C R, Cutting S M. , editors. Molecular biological methods for Bacillus. Chichester, England: John Wiley & Sons, Ltd.; 1990. pp. 27???74. </biblio> false false _199_ 0 3475 9 In stock true The AmyE integration sequence was taken from the vector after comparison by BLAST to the ''B.subtilis'' chromosome to identify the homologous sequences. The sequence present in both the host chromosome and the plasmid at the 5' end of the gene is the 5' sequence required for integration. true Chris Hirst annotation1974145 1 5' AmyE homologous sequence range1974145 1 1 522 BBa_K143067 1 BBa_K143067 AmyE integratable PoPS generator (P43-gsiB) 2008-10-25T11:00:00Z 2015-05-08T01:10:24Z The amyE 5' integration sequence was PCR cloned from the ''B. subtilis'' integration vector utilising Pfu DNA polymerase and cloned into a BioBrick with the P43-gsiB that was synthesised by GeneArt. AmyE 5' Integration sequence(<bbpart>BBa_K143001</bbpart>) coupled to the PoPS generator P43-gsiB (<bbpart>BBa_K143050</bbpart>). The amyE 5' integration sequence allows integration into the ''B. subtilis'' genome at the amyE locus if the 3' amyE integration sequence(<bbpart>BBa_K143002</bbpart>) is cloned onto the 3' end of the construct. The P43-gsiB promoter and RBS for ''B. subtilis'' constitutively generate a PoPS output. false false _199_ 0 3475 9 It's complicated false The amyE 5' integration sequence was PCR cloned from the ''B. subtilis'' integration vector pDR111 utilising Pfu DNA polymerase. The sequence of P43-gsiB was obtained from papers. false Chris Hirst component1990701 1 BBa_K143001 component1990706 1 BBa_K143013 component1990708 1 BBa_K143020 annotation1990701 1 BBa_K143001 range1990701 1 1 522 annotation1990706 1 BBa_K143013 range1990706 1 531 586 annotation1990708 1 BBa_K143020 range1990708 1 595 605 BBa_K143020 1 RBS-GsiB GsiB ribosome binding site (RBS) for B. subtilis 2008-09-14T11:00:00Z 2015-05-08T01:10:23Z The sequence was taken from a previous research paper [1] and was constructed by Geneart GsiB is an endogenous ribosome binding site from ''B.subtilis''. The sequence of the gsiB ribosome binding site is '''AAAGGAGG''' which is complementary to the sequence '''UUUCCUCC''' from the 3' region of the 16s rRNA from ''B.subtilis''. GsiB is an endogenous ribosome binding site (RBS) from ''B.subtilis''. The sequence of the gsiB ribosome binding site is '''AAAGGAGG''' which is complementary to the sequence '''UUUCCUCC''' from the 3' region of the 16s rRNA from ''B.subtilis''. Previous research showed that the predicted binding energy of the 16s rRNA to the RBS is -9.3kcal. false false _199_ 0 2090 9 Not in stock false In order to ensure that the RBS is functional the actual ribosome binding site was maintained and the distance between the RBS and the start codon maintained. In order to conform to the biobrick standard the sequence flanking the RBS had to be changed but the distance between the promoter and RBS, and start codon and RBS was maintained. false James Chappell annotation1975872 1 rbs range1975872 1 2 8 BBa_K143013_sequence 1 attttacatttttagaaatgggcgtgaaaaaaagcgcgcgattatgtaaaatataa BBa_K143020_sequence 1 taaaggaggaa BBa_K143067_sequence 1 atgtttgcaaaacgattcaaaacctctttactgccgttattcgctggatttttattgctgtttcatttggttctggcaggaccggcggctgcgagtgctgaaacggcgaacaaatcgaatgagcttacagcaccgtcgatcaaaagcggaaccattcttcatgcatggaattggtcgttcaatacgttaaaacacaatatgaaggatattcatgatgcaggatatacagccattcagacatctccgattaaccaagtaaaggaagggaatcaaggagataaaagcatgtcgaactggtactggctgtatcagccgacatcgtatcaaattggcaaccgttacttaggtactgaacaagaatttaaagaaatgtgtgcagccgctgaagaatatggcataaaggtcattgttgacgcggtcatcaatcataccaccagtgattatgccgcgatttccaatgaggttaagagtattccaaactggacacatggaaacacacaaattaaaaactggtctgatcgatactagagattttacatttttagaaatgggcgtgaaaaaaagcgcgcgattatgtaaaatataatactagagtaaaggaggaa BBa_K143001_sequence 1 atgtttgcaaaacgattcaaaacctctttactgccgttattcgctggatttttattgctgtttcatttggttctggcaggaccggcggctgcgagtgctgaaacggcgaacaaatcgaatgagcttacagcaccgtcgatcaaaagcggaaccattcttcatgcatggaattggtcgttcaatacgttaaaacacaatatgaaggatattcatgatgcaggatatacagccattcagacatctccgattaaccaagtaaaggaagggaatcaaggagataaaagcatgtcgaactggtactggctgtatcagccgacatcgtatcaaattggcaaccgttacttaggtactgaacaagaatttaaagaaatgtgtgcagccgctgaagaatatggcataaaggtcattgttgacgcggtcatcaatcataccaccagtgattatgccgcgatttccaatgaggttaagagtattccaaactggacacatggaaacacacaaattaaaaactggtctgatcga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z