BBa_K143012 1 Pveg Promoter veg a constitutive promoter for B. subtilis 2008-09-10T11:00:00Z 2015-05-08T01:10:23Z The Pveg promoter was suggested to us by Dr. Jan-Willem Veening of Newcastle University. This sequence supplied was compared to that of the DBTBS database<cite>#3</cite> then a section containing the binding site synthesised by Geneart. Released HQ 2013 Pveg is a constitutive promoter that constitutively expresses the P43 protein in ''B.subtilis''. Pveg contains binding sites for the ''B.sutbilis'' major sigma factor<cite>#1</cite>. Pveg in ''B.subtilis'' utilises two binding sites to cause high expression of genes<cite>#2</cite>, however our Pveg is lacking the upstream site to give a medium level of gene expression. It has been noted that the sporulation master regulatoion factor spoOA interacts with Pveg though it is not known how<cite>#3</cite>. The context with which we used the promoter Pveg is as a '''Polymerase Per Second''' (PoPS) generator. false true _199_ 0 2090 9 In stock false The biobrick part was designed to include a single binding site for the ''B.subtilis major sigma factor. In addition the biobrick standard was applied to the promoter Pveg sequence. false James Chappell annotation1975704 1 Sigma A-35 range1975704 1 63 68 annotation1975705 1 Sigma A -10 range1975705 1 86 91 BBa_K143069 1 BBa_K143069 AmyE integratable PoPS generator (Pveg-gsiB) 2008-10-25T11:00:00Z 2015-05-08T01:10:24Z The amyE 5' integration sequence was PCR cloned from the ''B. subtilis'' integration vector utilising Pfu DNA polymerase and cloned into a BioBrick with the Pveg-gsiB that was synthesised by GeneArt AmyE 5' Integration sequence(<bbpart>BBa_K143001</bbpart>) coupled to the PoPS generator Pveg-gsiB (<bbpart>BBa_K143052</bbpart>). The amyE 5' integration sequence allows integration into the ''B. subtilis'' genome at the amyE locus if the 3' amyE integration sequence(<bbpart>BBa_K143002</bbpart>) is cloned onto the 3' end of the construct. The Pveg-gsiB promoter and RBS for ''B. subtilis'' constitutively generate a PoPS output. false false _199_ 0 3475 9 It's complicated false The amyE 5' integration sequence was PCR cloned from the ''B. subtilis'' integration vector pDR111 utilising Pfu DNA polymerase. The sequence of Pveg-gsiB was obtained from papers. false Chris Hirst component2003613 1 BBa_K143012 component2003610 1 BBa_K143001 component2003615 1 BBa_K143020 annotation2003613 1 BBa_K143012 range2003613 1 531 627 annotation2003615 1 BBa_K143020 range2003615 1 636 646 annotation2003610 1 BBa_K143001 range2003610 1 1 522 BBa_K143020 1 RBS-GsiB GsiB ribosome binding site (RBS) for B. subtilis 2008-09-14T11:00:00Z 2015-05-08T01:10:23Z The sequence was taken from a previous research paper [1] and was constructed by Geneart GsiB is an endogenous ribosome binding site from ''B.subtilis''. The sequence of the gsiB ribosome binding site is '''AAAGGAGG''' which is complementary to the sequence '''UUUCCUCC''' from the 3' region of the 16s rRNA from ''B.subtilis''. GsiB is an endogenous ribosome binding site (RBS) from ''B.subtilis''. The sequence of the gsiB ribosome binding site is '''AAAGGAGG''' which is complementary to the sequence '''UUUCCUCC''' from the 3' region of the 16s rRNA from ''B.subtilis''. Previous research showed that the predicted binding energy of the 16s rRNA to the RBS is -9.3kcal. false false _199_ 0 2090 9 Not in stock false In order to ensure that the RBS is functional the actual ribosome binding site was maintained and the distance between the RBS and the start codon maintained. In order to conform to the biobrick standard the sequence flanking the RBS had to be changed but the distance between the promoter and RBS, and start codon and RBS was maintained. false James Chappell annotation1975872 1 rbs range1975872 1 2 8 BBa_K143001 1 amyE 5 IS 5??? Integration Sequence for the amyE locus of B. subtilis 2008-08-26T11:00:00Z 2015-05-08T01:10:23Z The 5??? integration sequence was taken from the shuttle vector pDR111 which has been used in many studies on ''B.subtilis'', in particular in the studies of transcriptional control<cite>#1 #2 #3</cite> <biblio> #1 pmid=14597697 #2 pmid=15937167 #3 pmid=12169614 </biblio> Released HQ 2013 The 5' integration sequence can be added to the front of a Biobrick construct and the 3' integration sequence specific for this locus (Part BBa_K143002) to the rear of the Biobrick construct to allow integration of the Biobrick construct into the chromosome of the gram positive bacterium B.subtilis. The AmyE locus was the first locus used for integration into ''B.subtilis'' by Shimotsu and Henner<cite>#1</cite> and is still commonly used in vectors such as pDR111<cite>#2</cite>, pDL<cite>#3</cite> and their derivatives. Integration at the AmyE locus removes the ability of ''B.subtilis'' to break down starch, which can be assayed with iodine as described by Cutting and Vander-horn<cite>#4</cite>. The 5' and 3' integration sequences for the AmyE locus were used to integrate the Imperial 2008 iGEM project primary construct into the ''B.sutbilis'' chromosome. <biblio> #1 pmid=3019840 #2 pmid=14597697 #3 ''Bacillus'' Genetic Stock Center [www.bgsc.org] #4 Cutting, S M.; Vander-Horn, P B. Genetic analysis. In: Harwood C R, Cutting S M. , editors. Molecular biological methods for Bacillus. Chichester, England: John Wiley & Sons, Ltd.; 1990. pp. 27???74. </biblio> false false _199_ 0 3475 9 In stock true The AmyE integration sequence was taken from the vector after comparison by BLAST to the ''B.subtilis'' chromosome to identify the homologous sequences. The sequence present in both the host chromosome and the plasmid at the 5' end of the gene is the 5' sequence required for integration. true Chris Hirst annotation1974145 1 5' AmyE homologous sequence range1974145 1 1 522 BBa_K143069_sequence 1 atgtttgcaaaacgattcaaaacctctttactgccgttattcgctggatttttattgctgtttcatttggttctggcaggaccggcggctgcgagtgctgaaacggcgaacaaatcgaatgagcttacagcaccgtcgatcaaaagcggaaccattcttcatgcatggaattggtcgttcaatacgttaaaacacaatatgaaggatattcatgatgcaggatatacagccattcagacatctccgattaaccaagtaaaggaagggaatcaaggagataaaagcatgtcgaactggtactggctgtatcagccgacatcgtatcaaattggcaaccgttacttaggtactgaacaagaatttaaagaaatgtgtgcagccgctgaagaatatggcataaaggtcattgttgacgcggtcatcaatcataccaccagtgattatgccgcgatttccaatgaggttaagagtattccaaactggacacatggaaacacacaaattaaaaactggtctgatcgatactagagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagtaaaggaggaa BBa_K143012_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgt BBa_K143020_sequence 1 taaaggaggaa BBa_K143001_sequence 1 atgtttgcaaaacgattcaaaacctctttactgccgttattcgctggatttttattgctgtttcatttggttctggcaggaccggcggctgcgagtgctgaaacggcgaacaaatcgaatgagcttacagcaccgtcgatcaaaagcggaaccattcttcatgcatggaattggtcgttcaatacgttaaaacacaatatgaaggatattcatgatgcaggatatacagccattcagacatctccgattaaccaagtaaaggaagggaatcaaggagataaaagcatgtcgaactggtactggctgtatcagccgacatcgtatcaaattggcaaccgttacttaggtactgaacaagaatttaaagaaatgtgtgcagccgctgaagaatatggcataaaggtcattgttgacgcggtcatcaatcataccaccagtgattatgccgcgatttccaatgaggttaagagtattccaaactggacacatggaaacacacaaattaaaaactggtctgatcga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z