BBa_K1431201 1 BBa_K1431201 NLS, lead protein into the nucleus 2014-10-08T11:00:00Z 2015-05-08T01:10:24Z This two NLS was from two sides in Cas9 sequence, plasmid px330, zhangfeng lab. A nuclear localization signal or sequence (NLS) is an amino acid sequence that "tags" a protein for import into the cell nucleus by nuclear transport[wikipedia]. We design two NLS which connect by dozens of nucleotides and can be inserted a coding sequence by BbsI site. The two NLS in each side of a protein may increase the probability of protein import into the cell nucleus. false false _1809_ 0 22882 9 In stock false We have anther kind of NLS but only with one side. We chose two NLS for it may increase the probability of protein import into the cell nucleus. As for BbsI site, we have a series same design sequence. You can get how BbsI site work by google, and the reason why we designed that because we want to make a seamless gather between NLS and protein or any triple nucleotides. That depend on which will make the highest efficiency. Sorry for the limited time, we do not test which will be the highest efficiency. false Rifei Chen, Yushan Zhang annotation2422985 1 BbsI site range2422985 1 58 63 annotation2422986 1 BbsI site range2422986 1 75 80 annotation2422983 1 NLS range2422983 1 5 55 annotation2422982 1 NLS range2422982 1 83 130 BBa_K1431201_sequence 1 ccagatggccccaaagaagaagcggaaggtcggtatccacggagtcccagcagccacgtcttcatggatcctatgaagactgaaaaggccggcggccacgaaaaaggccggccaggcaaaaaagaaaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z