BBa_K1431301 1 BBa_K1431301 TRE-3G promoter+SV40 PolyA, an ideal controller of mammalian gene expression with Tet-On 3G protein 2014-10-09T11:00:00Z 2015-05-08T01:10:24Z It is from our instructor's lab. pTRE-3G promoter is a kind of eukaryocyte cell promoters that will be switched on after connect with a compound which is TetOn protein and tetracycline[TetOn sequence see BBa_K1431101]. That is a very useful way to control whether protein express or not. Of course PolyA is needful in eukaryocyte cell. There are two BbsI sites between promoter and PolyA which can make the coding sequence seamless gather with them. So we can test how many nucleotides interval between promoter and coding sequence will make the highest expression efficiency. false false _1809_ 0 22882 9 It's complicated false For BbsI site, we have a series same design sequence. You can get how BbsI site work by google. And the reason why we designed that because we want to make coding sequence seamless gather with promoter and PolyA or any amount nucleotides. That depend on which will make the highest efficiency. Sorry for the limited time, we only test GFP seamless gather with promoter and PolyA but did not get the data which will make the highest efficiency. false Rifei Chen, Yushan Zhang annotation2422978 1 SV40 PolyA range2422978 1 410 540 annotation2422981 1 BbsI site range2422981 1 402 407 annotation2422980 1 BbsI site range2422980 1 386 391 annotation2422977 1 TRE 3G promoter range2422977 1 1 383 BBa_K1431301_sequence 1 tttaaactttactccctatcagtgatagagaacgtatgaagagtttactccctatcagtgatagagaacgtatgcagactttactccctatcagtgatagagaacgtataaggagtttactccctatcagtgatagagaacgtatgaccagtttactccctatcagtgatagagaacgtatctacagtttactccctatcagtgatagagaacgtatatccagtttactccctatcagtgatagagaacgtataagctttaggcgtgtacggtgggcgcctataaaagcagagctcgtttagtgaaccgtcagatcgcctggagcaattccacaacacttttgtcttataccaactttccgtaccacttcctaccctcgtaaatcgtcttcatggatctatgaagacccaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgtataccgtcgacctctcaattcatcactctcggcatgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z