BBa_K1431401 1 BBa_K1431401 One gRNA Sequence for HIV-1 2014-10-12T11:00:00Z 2015-05-08T01:10:24Z Conserved Region of the HIV-1 Genome from the NIH HIV-1 Sequence Database This is a gRNA for the HIV-1 Virus, designed by the 2014 iGEM Team SUSTC-Shenzhen. This part should be used along with a CRISPR system. false false _1809_ 0 22880 9 In stock false 1. Specificity and efficiency of the gRNA 2. 2nd structure of the gRNA 3. Endonuclease Sites false Fan Jiang, Peng Peng annotation2423133 1 BbsI site with a G in pSB1C3 range2423133 1 1 5 annotation2423134 1 BbsI site range2423134 1 41 46 annotation2423132 1 gRNA sequence for HIV-1 range2423132 1 12 34 BBa_K1431401_sequence 1 aagacctcacctctagcagtggcgcccgaacagggtttgggtcttc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z