BBa_K1431403 1 BBa_K1431403 gRNA2 for HBV 2014-10-13T11:00:00Z 2015-05-08T01:10:24Z we will complete this part later we will complete this part later false false _1809_ 0 22882 9 In stock false we will complete this part later false Fan Jiang, Peng Peng annotation2423199 1 BbsI site range2423199 1 41 46 annotation2423198 1 BbsI site with a G in pSB1C3 range2423198 1 1 5 annotation2423066 1 gRNA2 sequence for HBV range2423066 1 12 34 BBa_K1431403_sequence 1 aagacctcacctccgcagtatggatcggcagagggtttgggtcttc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z