BBa_K1431412 1 BBa_K1431412 target sequence1 for HBV 2014-10-13T11:00:00Z 2015-05-08T01:10:24Z we will complete this par later we will complete this par later false false _1809_ 0 22882 9 In stock false we will complete this par later false Fan Jiang, Peng Peng annotation2423502 1 gRNA binding sequence range2423502 1 5 27 BBa_K1431412_sequence 1 tcctaggacccctgctcgtgttacaggcgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z