BBa_K1431502 1 BBa_K1431502 Upstream Activation Sequence(UAS) bind to the GAL4 protein and then activate gene transcription 2014-10-11T11:00:00Z 2015-05-08T01:10:24Z Synthesis UAS(Upstream Activation Sequence)is a 17bp sequence that can be bind to yeast transcription activator protein GAL4. It usually locates in the upstream of a promoter so that GAL4's activation domain can activate the gene transcription. It usually works as GAL4/UAS system containing two parts: the GAL4 gene and reported gene containing UAS in human cell and ''Drosophila''．Cells contains this system can be detected more green fluorescence than the cells do not if the reporter gene is GFP. If you just use the DNA binding domain of GAL4. Your plasmid should not be included within the expression unit but at some other location on your DNA construct because the location of UAS should not have any influence on the expression of your gene of interest. Plasmids contains UAS bind to FRP5-DT-GAL4 or TGF-a-ETA-GAL4 chimeric fusion protein can be transferred into human cells. 2*UAS, 5*UAS and 7*UAS have different affinity with GAL4. 2*UAS and 5*UAS are separated from 7*UAS. false false _1809_ 0 22892 9 In stock false To be determine false Yongkang Long, Longze Su BBa_K1431502_sequence 1 cggagtactgtcctccgagcggagtactgtcctccgactcgagcggagtactgtcctccgatcggagtactgtcctccgcgatttccggagtactgtcctccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z