BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1431834 1 BBa_K1431834 amajLime, yellow-green chromoprotein reporter system (Weak Promoter, Strong RBS) 2014-10-13T11:00:00Z 2015-05-08T01:10:25Z Will be added later Will be added later false false _1809_ 0 14827 9 It's complicated false Will be added later false Yicong Tao, Yushan Zhang component2418885 1 BBa_J23106 component2418887 1 BBa_B0034 component2418896 1 BBa_B0015 component2418889 1 BBa_K1033916 annotation2418887 1 BBa_B0034 range2418887 1 44 55 annotation2418889 1 BBa_K1033916 range2418889 1 62 754 annotation2418885 1 BBa_J23106 range2418885 1 1 35 annotation2418896 1 BBa_B0015 range2418896 1 763 891 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_J23106 1 BBa_J23106 constitutive promoter family member 2006-08-13T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1033916 1 BBa_K1033916 amajLime, yellow-green chromoprotein 2013-08-24T11:00:00Z 2015-05-08T01:08:49Z The anemone Anemonia majano. This chromoprotein from the coral Anemonia majano, amajLime, naturally exhibits strong color when expressed. false false _1340_ 0 10137 9 In stock false Synthesized and codon optimized for E coli by GenScript. false Sabri Jamal annotation2332103 1 amajLime range2332103 1 1 690 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1033916_sequence 1 atggcactgagcaacaagtttatcggtgatgatatgaaaatgacgtaccacatggacggctgcgtgaacggccactactttacggtgaaaggtgaaggcaacggtaaaccgtatgaaggcacccagacgagcacctttaaagttacgatggcgaatggcggtccgctggcctttagtttcgatattctgtccaccgtctttaaatacggcaaccgttgcttcacggcgtatccgaccagcatgccggattactttaagcaagccttcccggacggcatgtcttatgaacgcacgtttacctacgaagatggcggtgtggcgaccgccagctgggaaatttctctgaaaggcaactgtttcgaacataagagtacctttcacggcgtgaatttcccggcagatggtccggttatggctaaaaagaccacgggttgggacccgtcatttgaaaaaatgacggtctgcgatggcatcctgaagggtgacgtgaccgcatttctgatgctgcaaggcggcggcaattatcgttgtcaattccatacgtcctacaaaaccaaaaagccggttacgatgccgccgaaccatgtggttgaacaccgtattgcgcgcaccgatctggacaaaggtggcaattcagttcagctgacggaacatgcagtcgctcacatcacctcggtcgtgccgttctaataa BBa_B0034_sequence 1 aaagaggagaaa BBa_J23106_sequence 1 tttacggctagctcagtcctaggtatagtgctagc BBa_K1431834_sequence 1 tttacggctagctcagtcctaggtatagtgctagctactagagaaagaggagaaatactagatggcactgagcaacaagtttatcggtgatgatatgaaaatgacgtaccacatggacggctgcgtgaacggccactactttacggtgaaaggtgaaggcaacggtaaaccgtatgaaggcacccagacgagcacctttaaagttacgatggcgaatggcggtccgctggcctttagtttcgatattctgtccaccgtctttaaatacggcaaccgttgcttcacggcgtatccgaccagcatgccggattactttaagcaagccttcccggacggcatgtcttatgaacgcacgtttacctacgaagatggcggtgtggcgaccgccagctgggaaatttctctgaaaggcaactgtttcgaacataagagtacctttcacggcgtgaatttcccggcagatggtccggttatggctaaaaagaccacgggttgggacccgtcatttgaaaaaatgacggtctgcgatggcatcctgaagggtgacgtgaccgcatttctgatgctgcaaggcggcggcaattatcgttgtcaattccatacgtcctacaaaaccaaaaagccggttacgatgccgccgaaccatgtggttgaacaccgtattgcgcgcaccgatctggacaaaggtggcaattcagttcagctgacggaacatgcagtcgctcacatcacctcggtcgtgccgttctaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z