BBa_K1433001 1 BBa_K1433001 attB-J23110-attP 2014-09-27T11:00:00Z 2015-05-08T01:10:25Z this parts are construct from BBa_J23110 by adding attB/attP sites using PCR Bxb1 gp35 is a serine integrase and Bxb1 gp47 is an excisionase in Mycobacterium phage Bxb1. This part is composed of 2 elements. 1. Promoter: BBa_J23110, a middle-ground Bacterial constitutive promoter.
 2. attB and attP sites: Recognition site for Bxb1 gp35, Mycobacterium Phage Bxb1 DNA integrase. This part promotes transcription and translation downstream gene, and when treat with Bxb1 gp35, upstream gene will express. false false _1811_ 0 20519 9 It's complicated false No false Chaofan Zhang annotation2412262 1 attB range2412262 1 1 49 annotation2412264 1 attP range2412264 1 85 137 annotation2412263 1 J23110 Promoter range2412263 1 50 84 BBa_K1433001_sequence 1 cggccggcttgtcgacgacggcggtctccgtcgtcaggatcatccgggctttacggctagctcagtcctaggtacaatgctagcgggtttgtaccgtacaccactgagaccgcggtggttgaccagacaaaccacga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z