BBa_K1438000 1 BFR Bacterioferritin (BFR) 2014-09-12T11:00:00Z 2015-07-22T02:12:09Z Bacterioferritin from E. coli Nissle 1917 genomic DNA. Amplified by using PCR and cloned into pQE80L Bacterioferritins are the E. coli cells natural iron storage proteins. These hollow nearly spherical protein shells detoxify the cell by sequestering excessive iron and forming Iron(III)hydroxid-oxide particels. Bacterioferritin is an heam containing bacterial ferritin. Each heme is bound in a pocked formed by the interface between a pair of symmetry-related subunits [1]. However, it was investigated that these heme groups may be involved in the release of iron out of the ferritin iron core by forming an heme-mediated electron transfer to reduce immobilized Fe3+ to more soluble Fe2+. [1] Frolow F, Kalb AJ, Yariv J. Structure of a unique twofold symmetric haem-binding site. Nat Struct Biol. 1994 Jul;1(7):453-60. PubMed PMID: 7664064. [2] Yao H, Wang Y, Lovell S, Kumar R, Ruvinsky AM, Battaile KP, Vakser IA, Rivera M. The structure of the BfrB-Bfd complex reveals protein-protein interactions enabling iron release from bacterioferritin. J Am Chem Soc. 2012 Aug 15;134(32):13470-81. doi: 10.1021/ja305180n. Epub 2012 Aug 1. PubMed PMID: 22812654; PubMed Central PMCID: PMC3428730. false false _1816_ 4206 19714 9 It's complicated true For any metal nanoparticles built inside of BFR it would be beneficary to remove any heme groups in order to prevent unloading of BFR by heme-mediated electron transfer. false Johann Bauerfeind annotation2398525 1 His Tag range2398525 1 13 30 annotation2398554 1 BioBrick range2398554 1 1 513 annotation2398526 1 stop codon range2398526 1 511 513 annotation2383111 1 start codon range2383111 1 1 3 BBa_K1438000_sequence 1 atgagaggatcgcatcaccatcaccatcacatgggatccaaaggtgatactaaagttataaattatctcaacaaactgttgggaaatgagcttgtcgcaatcaatcagtactttcttcatgcccggatgtttaaaaactggggtctcaaacgtctcaatgatgtggagtatcatgaatccattgatgagatgaaacacgccgatcgttatattgagcgcattctttttctggaaggtcttccaaacttacaggacctgggcaaactgaacattggtgaagatgttgaggaaatgctgcgttctgatctggcacttgagctggatggcgcgaagaatttgcgtgaggcaattggttatgccgatagcgttcatgattacgtcagccgcgatatgatgatagaaattttgcgcgatgaagaaggccatatcgactggctggaaacggaacttgatctgattcagaagatgggactgcaaaattatctgcaagcacagattcgcgaagaaggttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z