BBa_K1439000 1 OriTRP4 Origin of transfer for the RP4-plasmid nic region. 2014-09-27T11:00:00Z 2015-05-08T01:10:25Z This part comes form the RP4 plasmid,from 51098bp to 51448bp. OriTRP4,the RP4 plasmid nic region,is where the relaxosome nicks the plasmid and conjugative transfer by R plasmid machinery begins. false false _1817_ 0 21790 9 It's complicated false OriTRP4 region contains some promoters,we put it in the back of terminator.In order to reduce the impact on protein expression. false Wenqi Li BBa_K1439000_sequence 1 gcttgccctcatctgttacgccggcggtagccggccagcctcgcagagcaggattcccgttgagcaccgccaggtgcgaataagggacagtgaagaaggaacacccgctcgcgggtgggcctacttcacctatcctgcccggctgacgccgttggatacaccaaggaaagtctacacgaaccctttggcaaaatcctgtatatcgtgcgaaaaaggatggatataccgaaaaaatcgctataatgaccccgaagcagggttatgcagcggaaaagcgctgcttccctgctgttttgtggaatatctaccgactggaaacaggcaaatgcaggaaattactgaactgaggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z