BBa_K1439004 1 BBa_K1439004 TAT-H4 2014-10-04T11:00:00Z 2015-05-08T01:10:26Z Histone H4 comes from the Wheat histone H4 gene, and TAT-PTD comes from HIV-1's TAT protein gene. Histone H4 can efficiently mediate gene transfer, it rich in positively charged alkaline amino acids and has the ability to combine with DNA. TAT-PTD contains an 11-amino acid peptide, and these amino acids YGRKKRRQRRR are highly basic, which is crucial for penetrating the plasma membrane. We use linker to link H4 histone and TAT, thus it can seize DNA and take it into cells. Now, it becomes our transfer device. false false _1817_ 0 21804 9 It's complicated false We found the sequence from NCBI, and synthetized primer. false Zhaoliang Chen annotation2394213 1 misc range2394213 1 1 393 BBa_K1439004_sequence 1 atgtatggtcgtaaaaaacgtcgtcagcgtcgtcgcggtggaggaggctctggtggaggcggtagcggaggcggagggtcgatgtccgggcgcggcaagggaggcaagggcctaggcaagggcggcgccaagcgccaccggaaggtcctccgcgataacatccagggcatcaccaagccggcgatccggcggctggcgcggcggggcggcgtgaagcgcatctcggggctcatctacgaggagacccgcggcgtgctcaagatcttcctcgagaacgtcatccgcgatgccgtcacctacaccgagcacgcccgccgcaagaccgtcaccgccatggacgtcgtctacgcgctcaagcgccagggccgcaccctctacggcttcggcggctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z