BBa_K1439005 1 BBa_K1439005 TAT-PTD 2014-10-04T11:00:00Z 2015-05-08T01:10:26Z It comes from the HIV-1's TAT protein. Protein transduction domain TAT(PTD-tat) is a lower-molecular-weight polypeptide which can across the cytoplasmic membrane of mammals. This polypeptide has been used in many fileds of protein treatment。Researchers genetically incorporated PTD-tat with other proteins and using it to guide protein getting into cells. PTD-tat contains an 11-amino acid peptide of human immunodeficiency viruses type 1(HIV-1) tat protein. These amino acids YGRKKRRQRRR are highly basic, which is crucial for penetrating the plasma membrane false false _1817_ 0 21804 9 It's complicated false We got the sequence from the NCBI false Zhaoliang Chen annotation2394224 1 misc range2394224 1 1 36 BBa_K1439005_sequence 1 atgtatggtcgtaaaaaacgtcgtcagcgtcgtcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z