BBa_K1439006 1 BBa_K1439006 Histone H4 2014-10-04T11:00:00Z 2015-05-08T01:10:26Z Wheat histone H4 gene Protein/peptide-mediated gene delivery has recently emerged as a powerful approach in non-viral gene transfer. Histone H4 has the ability to deliver gene, it rich in positively charged alkaline amino acids, thus it can combine with DNA. false false _1817_ 0 21804 9 Not in stock false We got the sequence from NCBI false Zhaoliang Chen annotation2394247 1 misc range2394247 1 1 312 BBa_K1439006_sequence 1 atgtccgggcgcggcaagggaggcaagggcctaggcaagggcggcgccaagcgccaccggaaggtcctccgcgataacatccagggcatcaccaagccggcgatccggcggctggcgcggcggggcggcgtgaagcgcatctcggggctcatctacgaggagacccgcggcgtgctcaagatcttcctcgagaacgtcatccgcgatgccgtcacctacaccgagcacgcccgccgcaagaccgtcaccgccatggacgtcgtctacgcgctcaagcgccagggccgcaccctctacggcttcggcggctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z