BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K1439004 1 BBa_K1439004 TAT-H4 2014-10-04T11:00:00Z 2015-05-08T01:10:26Z Histone H4 comes from the Wheat histone H4 gene, and TAT-PTD comes from HIV-1's TAT protein gene. Histone H4 can efficiently mediate gene transfer, it rich in positively charged alkaline amino acids and has the ability to combine with DNA. TAT-PTD contains an 11-amino acid peptide, and these amino acids YGRKKRRQRRR are highly basic, which is crucial for penetrating the plasma membrane. We use linker to link H4 histone and TAT, thus it can seize DNA and take it into cells. Now, it becomes our transfer device. false false _1817_ 0 21804 9 It's complicated false We found the sequence from NCBI, and synthetized primer. false Zhaoliang Chen annotation2394213 1 misc range2394213 1 1 393 BBa_K1439008 1 BBa_K1439008 TAT-H4-B0015 2014-10-04T11:00:00Z 2015-05-08T01:10:26Z TAT-H4 comes from the BBa_K1439004 and the Terminator comes from BBa_B0015 H4 histone can efficiently mediate gene transfer, it rich in positively charged alkaline amino acids and has the ability to combine with DNA. TAT-PTD contains an 11-amino acid peptide, and these amino acids YGRKKRRQRRR are highly basic, which is crucial for penetrating the plasma membrane. We use linker to link H4 histone and TAT, thus it can seize DNA and take it into cells. Now, it becomes our transfer device. false false _1817_ 0 21804 9 It's complicated false We got them form iGEM. false Zhaoliang Chen component2394294 1 BBa_K1439004 component2394301 1 BBa_B0015 annotation2394294 1 BBa_K1439004 range2394294 1 1 393 annotation2394301 1 BBa_B0015 range2394301 1 402 530 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1439004_sequence 1 atgtatggtcgtaaaaaacgtcgtcagcgtcgtcgcggtggaggaggctctggtggaggcggtagcggaggcggagggtcgatgtccgggcgcggcaagggaggcaagggcctaggcaagggcggcgccaagcgccaccggaaggtcctccgcgataacatccagggcatcaccaagccggcgatccggcggctggcgcggcggggcggcgtgaagcgcatctcggggctcatctacgaggagacccgcggcgtgctcaagatcttcctcgagaacgtcatccgcgatgccgtcacctacaccgagcacgcccgccgcaagaccgtcaccgccatggacgtcgtctacgcgctcaagcgccagggccgcaccctctacggcttcggcggctaa BBa_K1439008_sequence 1 atgtatggtcgtaaaaaacgtcgtcagcgtcgtcgcggtggaggaggctctggtggaggcggtagcggaggcggagggtcgatgtccgggcgcggcaagggaggcaagggcctaggcaagggcggcgccaagcgccaccggaaggtcctccgcgataacatccagggcatcaccaagccggcgatccggcggctggcgcggcggggcggcgtgaagcgcatctcggggctcatctacgaggagacccgcggcgtgctcaagatcttcctcgagaacgtcatccgcgatgccgtcacctacaccgagcacgcccgccgcaagaccgtcaccgccatggacgtcgtctacgcgctcaagcgccagggccgcaccctctacggcttcggcggctaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z