BBa_K1441007 1 BBa_K1441007 Mambalgin-1 reverse Primer 2014-10-03T11:00:00Z 2015-05-08T01:10:26Z We designed this primer in our lab and ordered the DNA through IDT This Mambalgin-1 reverse primer is being used to amplify mambalgin DNA sequence through PCR or approve successful ligation of mambalgin into plasmid backbone through PCR. false false _1819_ 0 18396 9 Not in stock true We had to add one or more nucleotide to take care of unexpected stop codon(s). false Reza Alavi BBa_K1441007_sequence 1 gcatctgtctgttgagcaacac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z