BBa_K1441018 1 BBa_K1441018 pGMCSF1 2014-10-09T11:00:00Z 2015-05-08T01:10:26Z This primer is specific to the Bio-bricks prefix preceding the MSC in pGAP vectors. This primer was designed to remove the stop codon present in the standardized iGEM prefixes. This allows for proper insertion and expression of the insert into pGAPz vectors. Primers were designed from the pGAP vectors. false false _1819_ 0 12451 9 It's complicated false Primers specific for the alteration of IGEM prefixes. The melting temperatures and annealing temperatures of the primers had to be taken into consideration when designing the primers. false Matthew Brewer BBa_K1441018_sequence 1 tctcgagaagagagaggctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z