BBa_K1441019 1 BBa_K1441019 pGMCSR1 2014-10-09T11:00:00Z 2015-05-08T01:10:26Z This primer is specific to the Bio-bricks suffix following the pGAPz vector. This primer was designed to remove the stop codon present in the standardized iGEM suffixes. This allows for proper amplification, insertion and expression of the insert into pGAPz vectors. Primers were designed from the pGAPz vectors. false false _1819_ 0 12451 9 It's complicated false Primers specific for the alteration of IGEM suffixes. The melting temperatures and annealing temperatures of the primers had to be taken into consideration when designing the primers. false Matthew Brewer BBa_K1441019_sequence 1 gcccaacttgaactgaggaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z