BBa_K1442006 1 FZ Anti-theophylline Aptazyme 2014-08-13T11:00:00Z 2015-05-08T01:10:26Z http://nar.oxfordjournals.org/content/early/2013/04/12/nar.gkt253.full An aptazyme is a regulatory RNA element acting as a riboswitch in response to theophylline, a drug used to treat asthma and other chronic obstructive pulmonary diseases. Theophylline is not endogenous to the body therefore we used this element as a "kill switch" for our system. false false _1820_ 0 21957 9 It's complicated true None required as was Biobrick compatible false Caroline de Cock annotation2417091 1 MluI restriction site range2417091 1 106 113 annotation2417090 1 MauBI restriction site range2417090 1 1 8 annotation2417092 1 Anti-theophylline aptazyme range2417092 1 9 105 BBa_K1442006_sequence 1 cgcgcgcgtctccttcggtacatccagctgatgagtcccaaataggacgaaatacataccagccgaaaggcccttggcaggtgtcctggattccacgaaggagataaacgcgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z