BBa_K1442025 1 BBa_K1442025 Theophylline Aptazyme 2014-08-27T11:00:00Z 2015-05-08T01:10:26Z Synthetically designed sequence The aptazyme is a RNA sequence that can be placed into a construct for design purposes (e.g. safety, regulatory), the aptazyme self-cleaves in the presence of theophylline to destroy the construct, preventing translation, transcription etc. false false _1820_ 0 23056 9 Not in stock false Optimising the theophylline concentration due to its toxicity that self-cleaving effect will remain. false Yin Ho Vong BBa_K1442025_sequence 1 gaattcgcggccgcttctagagcgcgcgcgtctccttcggtacatccagctgatgagtcccaaataggacgaaatacataccagccgaaaggcccttggcaggtgtcctggattccacgaaggagataaacgcgttactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z