BBa_K1442026 1 BBa_K1442026 siRNA target to human DPP-IV mRNA 2014-08-27T11:00:00Z 2015-05-08T01:10:26Z Derived from reverse complement of a conserved sequence of DPP-IV mRNA This is the sequence of a siRNA to human DPP-IV mRNA, upon binding of siRNA to its complementary form, it will then be destroyed via in vivo ds-RNA removal processes. false false _1820_ 0 23056 9 Not in stock false Design to ensure it was reverse-complemented and also complementary to a conserved sequence. false Yin Ho Vong BBa_K1442026_sequence 1 gaattcgcggccgcttctagagcgcgcgcggaatataaaggaatgccaggaggaaggaatctttataaaatccaacttagtgactatacaaaagtgacatgcctcagttgtgagctgaatccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z