BBa_K1442039 1 BBa_K1442039 P2A self-cleaving peptide sequence 2014-09-03T11:00:00Z 2015-05-08T01:10:26Z http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0018556#pone-0018556-g006 The P2A RNA sequence causes translation to skip when the ribosome reads the sequence. false false _1820_ 0 23056 9 Not in stock true None. false Yin Ho Vong BBa_K1442039_sequence 1 ggaagcggagctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z