BBa_K1442043 1 BBa_K1442043 T7 Terminator 2014-09-03T11:00:00Z 2015-05-08T01:10:26Z Soler Bistu??. Antimicrob. Agents Chemother. 2007, 51:1918 A T7 terminator stops transcription of a mRNA strand when placed on the 3' end of the RNA sequence. false false _1820_ 0 23056 9 Not in stock false None. false Yin Ho Vong BBa_K1442043_sequence 1 tagcataaccccttggggcctctaaacgggtcttgaggggttttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z