BBa_K1442029 1 BBa_K1442029 T7 Promoter Soler Bistue 2014-09-03T11:00:00Z 2015-05-08T01:10:26Z Sequence obtained from Soler Bistu??. Antimicrob. Agents Chemother. 2007, 51:1918 The T7 promoter is used to initiate transcription when placed at the 5' end of a DNA sequence false false _1820_ 0 23056 9 Not in stock false 3 Gs at the end are essential for T7 RNAP false Caroline de Cock BBa_K1442304 1 BBa_K1442304 SLD3 RdRP Promoter 3 2014-10-14T11:00:00Z 2015-05-08T01:10:27Z http://www.ncbi.nlm.nih.gov/pmc/articles/PMC113194/ This is a promoter we tested with our RdRp that was derived from the 3' untranslated region of the Brome Mosaic Virus and forms a stem loop that forms an additional canonical structure that attracts the polymerase. false false _1820_ 0 21957 9 Not in stock true None false Caroline de Cock annotation2420057 1 AflII restriction site range2420057 1 1 6 annotation2420060 1 BsiWI restriction site range2420060 1 112 117 annotation2420059 1 Hammerhead Ribozyme range2420059 1 40 111 annotation2420058 1 SLD3 range2420058 1 7 39 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1442301 1 BBa_K1442301 T7 terminator Soler Bistue 2014-10-12T11:00:00Z 2015-05-08T01:10:27Z http://www.plosone.org/article/fetchObject.action?uri=info%3Adoi%2F10.1371%2Fjournal.pone.0047690&representation=PDF T7 terminator Soler Bistue. Terminates transpcription when added at the 3' end of a sequence false false _1820_ 0 21957 9 Not in stock true None false Caroline de Cock BBa_K1442302 1 BBa_K1442302 Reverse GFP codon optimised for E.coli 2014-10-14T11:00:00Z 2015-05-08T01:10:27Z igem registry Reverse GFP adapted from Aequerea victoria and codon optimised using IDT codon optimiser for use in Escherichia coli false false _1820_ 0 21957 9 Not in stock false codon optimised using IDT codon optimiser false Caroline de Cock annotation2420073 1 GFP codon optimised for E.coli range2420073 1 1 690 BBa_K1442102 1 RGE Reverse GFP for E.coli 2014-10-06T11:00:00Z 2015-05-08T01:10:26Z ... GFP oriented in the negative sense for use in E.coli. Combined with other parts to act as testing modules. false false _1820_ 0 23055 9 It's complicated true ... false Becky Seeley component2420083 1 BBa_K1442304 component2420074 1 BBa_K1442029 component2420084 1 BBa_K1442301 component2420078 1 BBa_B0034 component2420076 1 BBa_K1442302 annotation2420083 1 BBa_K1442304 range2420083 1 730 846 annotation2420084 1 BBa_K1442301 range2420084 1 847 892 annotation2420078 1 BBa_B0034 range2420078 1 718 729 annotation2420074 1 BBa_K1442029 range2420074 1 1 27 annotation2420076 1 BBa_K1442302 range2420076 1 28 717 BBa_K1442301_sequence 1 tagcataaccccttggggcctctaaacgggtcttgaggggtttttt BBa_B0034_sequence 1 aaagaggagaaa BBa_K1442029_sequence 1 gcgaaattaatacgactcactataggg BBa_K1442304_sequence 1 cttaaggggcgcgccggcttgcatagcaagtctgagaccggccggcatggtcccagcctcctcgctggcgccggctgggcaacaccattgcactccggtggcgaatgggaccgtacg BBa_K1442102_sequence 1 gcgaaattaatacgactcactatagggcgtaatgccagccgcagtgacaaattccagaagcaccatgtgatcgcgcttctcgttaggatctttactcagcgcgctctgtgttgataagtaatggttatccggcaacaggacgggaccatcaccgataggggtattctgttggtaatgatctgccaactgcacgctgccatcttcaatgttatggcgaattttaaaattcactttgataccatttttctgcttgtccgccatgatgtacacgttgtgggaattatagttgtactccagtttatggcccaggatattgccgtcctctttaaaatcaatgcctttcagctcgatacgattcaccagggtatcaccttcgaatttaacttcagcccgagtcttataattaccatcgtctttaaagaaaatggtgcgttcctgcacataaccctccggcattgccgacttaaaaaaatcgtgctgcttcatgtgatccgggtagcgtgcaaaacactgaaccccgtaaccaaaggttgttaccaaggtcggccatggcaccggcagcttacccgtggtacaaatgaatttcagggtcaatttcccataggtggcgtcaccttctccttcgccagagactgaaaatttatggccattcacgtcgccgtcgagttccacaagaataggcacaacgccggtaaacagttcttcgcctttacgcataaagaggagaaacttaaggggcgcgccggcttgcatagcaagtctgagaccggccggcatggtcccagcctcctcgctggcgccggctgggcaacaccattgcactccggtggcgaatgggaccgtacgtagcataaccccttggggcctctaaacgggtcttgaggggtttttt BBa_K1442302_sequence 1 cgtaatgccagccgcagtgacaaattccagaagcaccatgtgatcgcgcttctcgttaggatctttactcagcgcgctctgtgttgataagtaatggttatccggcaacaggacgggaccatcaccgataggggtattctgttggtaatgatctgccaactgcacgctgccatcttcaatgttatggcgaattttaaaattcactttgataccatttttctgcttgtccgccatgatgtacacgttgtgggaattatagttgtactccagtttatggcccaggatattgccgtcctctttaaaatcaatgcctttcagctcgatacgattcaccagggtatcaccttcgaatttaacttcagcccgagtcttataattaccatcgtctttaaagaaaatggtgcgttcctgcacataaccctccggcattgccgacttaaaaaaatcgtgctgcttcatgtgatccgggtagcgtgcaaaacactgaaccccgtaaccaaaggttgttaccaaggtcggccatggcaccggcagcttacccgtggtacaaatgaatttcagggtcaatttcccataggtggcgtcaccttctccttcgccagagactgaaaatttatggccattcacgtcgccgtcgagttccacaagaataggcacaacgccggtaaacagttcttcgcctttacgcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z