BBa_K1442113 1 BBa_K1442113 siRNA for DPP-IV 2014-10-10T11:00:00Z 2015-05-08T01:10:27Z The sequence was obtained from the paper Inamoto et al, 2007 who used TAKARA BIO to design the siRNA. Inamoto et al (2007). Humanised anti CD-26 monoclonal antibody as a treatment for Malignant Mesothelioma Tumours. Clinical cancer research; volume 13. 4191-4200 siRNA are small interfering RNAs are strings of double stranded RNA (dsRNA) 20-24 base pairs long generated from longer strings of dsRNA. This dsRNA attracts the mammalian protein DICER, as dsRNA is not normal in mammalian cells. DICER will then process the dsRNA into smaller 22 base pair siRNAs. The siRNA duplex will then the RISC complex which will unwind the RNA so that it is single stranded. This can then bind to the target sequence to form more dsRNA which will be destroyed by the cell and inhibit transcription. DICER and RISC are part of the innate immune system to defend cells against viral infection ??? dsRNA is a feature that many viruses exhibit. The siRNA we have use is used to target the 3???UTR of the protein DPP-IV (CD26), the sequence for this siRNA has been used previously by inamoto et al, 2007 to knock down DPP-IV. However the flanking sequences have been designed so that the siRNA is only targeted by DICER in the negative sense. USAGE The siRNA was intended to be used to knockdown DPP-IV. This is a schematic of the entire replicon indicating the location of the siRNA in the replicon Diagram generated by genious shows the location of the siRNA in the first synthesis module. A section of DPP-IV 3???UTR BBa_K1442111 in the testing module forwards GFP for human cells BBa_K11442106 was intended to be used to test the siRNA. false false _1820_ 0 23057 9 Not in stock true The sequences surrounding the siRNA were designed so that in the positive sense there are no double stranded regions long enough to be recognised by DICER. This is gone by there being a lot of GU pairings in the negative sense so the hairpin that DICER recognises is present but in the positive sense the two regions are not complementary. false Becky Seeley annotation2416927 1 siRNA sequence range2416927 1 39 59 BBa_K1442113_sequence 1 ggagggtgttggtgctgttcctaacactgtgaccttcgaatagtactgacacctttcctaaaagcaccagcgctagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z