BBa_K1442116 1 BBa_K1442116 SLC8 3 2014-10-15T11:00:00Z 2015-05-08T01:10:27Z Brome Mosaic Virus Each unique RNA dependent RNA polymerase (RdRP) initiates de novo replication of a RNA strand by interacting with RdRP-specific RNA sequences, henceforth called RdRP/RNA promoters. The RdRP chosen for our project is taken from the Hepatitis C virus (HCV). The SLC8 RNA promoter was identified as such by Heinz, Kao (2000) , along with a number of other sequences. All of them possess a few common characteristics: an initiation cytidylate at the 3??? end, where the replication starts; and a stable secondary structure- single stranded tail and a stem of various length. Replication stops at the 5??? end. Please refer to Section: RdRP-directed Replication for further details. This is a genomic plus-strand RNAs that can direct BMV minus-strand initiation and is derived from the 3??? terminal of the Brome Mosaic Virus which forms tRNA like structures. There is a stem loop structure within this, named SLC, that is seen to direct replication. This is also from the BMV SLC loop but has 8 nucleotides added to it which contain the 3??? initiation site CCA. false false _1820_ 0 20675 9 Not in stock true Gel electrophoresis showing replication by HCV RdRP of a number of potential RNA promoters. The bands show the amount of replicated product and its approximate length, and quantify the tendency to produce strands of wrong size. SLC8 (lane 9) is performs very well in directing replication of the full template and produces a small amount of products with an incorrect size. false Iva Burova annotation2421062 1 Ribozyme range2421062 1 54 123 annotation2421061 1 RNA Promoter range2421061 1 7 53 BBa_K1442116_sequence 1 agcttaagggacgcatgggcttgcatagcaagtctagatatgcgtccagagaccaggccggcatggtcccagcctcctcgctggcgccggctgggcaacaccattgcactccggtggcgaatgggaccgtacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z