BBa_K1442300 1 BBa_K1442300 T7 Promoter Soler Bistue 2014-10-12T11:00:00Z 2015-05-08T01:10:27Z http://www.plosone.org/article/fetchObject.action?uri=info%3Adoi%2F10.1371%2Fjournal.pone.0047690&representation=PDF This is a T7 Promoter. Used to transcribe the plasmid in vivo in T7 containing cells such as BL21 (used in our experiments) or in vitro false false _1820_ 0 21957 9 Not in stock true None false Caroline de Cock BBa_K1442300_sequence 1 gcgaaattaatacgactcactataggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z