BBa_K1442301 1 BBa_K1442301 T7 terminator Soler Bistue 2014-10-12T11:00:00Z 2015-05-08T01:10:27Z http://www.plosone.org/article/fetchObject.action?uri=info%3Adoi%2F10.1371%2Fjournal.pone.0047690&representation=PDF T7 terminator Soler Bistue. Terminates transpcription when added at the 3' end of a sequence false false _1820_ 0 21957 9 Not in stock true None false Caroline de Cock BBa_K1442301_sequence 1 tagcataaccccttggggcctctaaacgggtcttgaggggtttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z