BBa_K1443001 1 BBa_K1443001 Lambda Repressor OR3-OR2-OR1-pR 2014-10-04T11:00:00Z 2015-05-08T01:10:27Z Synthesized from Lambda repressor sequence This part can be used in a Lambda repressor system using CI protein as an activator/repressor. false false _1821_ 0 20708 9 It's complicated false - false Laura Laakso annotation2407318 1 OR1 range2407318 1 48 64 annotation2407319 1 pR range2407319 1 65 72 annotation2407320 1 OR2 range2407320 1 24 40 annotation2407317 1 OR3 range2407317 1 1 17 BBa_K1443001_sequence 1 tatcaccgcaagggataaatatctaacaccgtgcgtgttgactattttacctctggcggtgataatggttgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z