BBa_K1443002 1 BBa_K1443002 Lambda Repressor OR1-OR2-OR3-pRM 2014-10-04T11:00:00Z 2015-05-08T01:10:27Z Synthesized from Lambda repressor sequence This part can be used in a Lambda repressor system using CI protein as an activator/repressor. false false _1821_ 0 20704 9 It's complicated false - false Laura Laakso annotation2402377 1 OR3 range2402377 1 48 64 annotation2402378 1 pRM range2402378 1 65 75 annotation2402376 1 OR2 range2402376 1 25 41 annotation2402375 1 OR1 range2402375 1 1 17 BBa_K1443002_sequence 1 tatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttatcccttgcggtgataagatttaacgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z