BBa_K1443003 1 BBa_K1443003 RFP Binding Forward Primer for Backbone Amplification 2014-10-08T11:00:00Z 2015-05-08T01:10:27Z The RFP coding device sequence. With this primer and its reverse counterpart you can amplify backbones that have RFP as the insert with PCR. The forward primer binds to the end of the RFP coding sequence. These primers don't have palindromic sites. false false _1821_ 0 20708 9 Not in stock false None. false Lassi Vapaakallio BBa_K1443003_sequence 1 ggtgggcctttctgcgttta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z