BBa_K090505 1 BBa_K090505 ''Bacillus subtilis'' consensus RBS 2008-10-27T12:00:00Z 2015-05-08T01:08:37Z This part was synthesized directly. This is the consensus RBS for Bacillus subtilis. false false _188_ 0 3501 9 Not in stock false The part must be 8 nucleotides away from the first methionine of the coding sequence, and so we added 'TGT' downstream of the actual binding sequence: AAAGGAGG. This, combined with the truncated non-CDS BioBrick prefix scar, gives exactly 8 'spacer bases' between the 3' end of the RBS and the start of the coding sequence. false Daniel Goodman annotation1992802 1 B. subtilis consensus RBS range1992802 1 1 8 BBa_R0051 1 cI lam promoter (lambda cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z <a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000 Released HQ 2013 The cI regulated promoter is based on the pR promtoer from bacteriohage lambda. The promoter has two two DNA binding sites for lambda cI repressor <bb_part>BBa_C0051</bb_part>. cI binding results in repression of transcription. The specific sequence used here is based on the cI repressible promoter used in the Elowitz repressilator (and references therein).</P> false true _1_ 0 24 7 In stock false <P> <P>In order to address concerns about the promoter transcribing in the reverse direction, we have removed the -35 and -10 signals responsible for the promoter activity in the reverse direction. (<b><font color="red">More details needed here! DE, 2/24/03</font></b>)<P> Incompatible with host expressing cI repressor. true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation7067 1 BBa_R0051 range7067 1 1 49 annotation2023 1 -35 range2023 1 15 20 annotation2024 1 OR1 range2024 1 25 41 annotation2025 1 OR2 range2025 1 1 17 annotation2022 1 -10 range2022 1 38 43 BBa_K823003 1 BBa_K823003 P<sub>veg</sub> 2012-07-15T11:00:00Z 2015-05-08T01:13:29Z Bacillus subtilis Released HQ 2013 Pveg is a strong, constitutive promoter of Bacillus subtilis false false _1081_ 0 12081 9 In stock false no considerations false Korinna Kraft annotation2190180 1 promoter range2190180 1 1 237 BBa_K1444002 1 BBa_K1444002 Composite promoter and consensus <i>B.subtilis</i> RBS - <i>C1-&lambda;</i> 2014-10-07T11:00:00Z 2015-05-08T01:10:27Z B. subtilis A composite part consisting of the constitutive promoter Pveg (BBa_K823003), followed by of the repressible promoter C1-lambda (BBa_R0051), and ending with the consensus RBS from B. subtilis (BBa_K090505). This composite part was intended to control the expression of a downstream reporter, regulated by the expression of the pLacI repressor protein. The constitutive promoter Pveg allows reliable expression when the repressible promoter is not repressed. false false _1822_ 0 20978 9 It's complicated false No interference with endogenous cell signalling. false Dan Ziemianowicz component2422419 1 BBa_R0051 component2422417 1 BBa_K823003 component2422424 1 BBa_K090505 annotation2422424 1 BBa_K090505 range2422424 1 303 313 annotation2422419 1 BBa_R0051 range2422419 1 246 294 annotation2422417 1 BBa_K823003 range2422417 1 1 237 BBa_K823003_sequence 1 ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagt BBa_R0051_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgc BBa_K1444002_sequence 1 ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagttactagagtaacaccgtgcgtgttgactattttacctctggcggtgataatggttgctactagagaaaggaggtgt BBa_K090505_sequence 1 aaaggaggtgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z