BBa_K780002 1 R37 Strong RBS for Bacillus Subtilis 2012-09-25T11:00:00Z 2015-05-08T01:13:18Z 'host-takover module' from B.subtilis Bacteriophage SPO1 Strong RBS for Bacillus Subtilis false false _1034_ 0 10113 9 It's complicated false - false Krzysztof Szczepaniak BBa_R0051 1 cI lam promoter (lambda cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z <a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000 Released HQ 2013 The cI regulated promoter is based on the pR promtoer from bacteriohage lambda. The promoter has two two DNA binding sites for lambda cI repressor <bb_part>BBa_C0051</bb_part>. cI binding results in repression of transcription. The specific sequence used here is based on the cI repressible promoter used in the Elowitz repressilator (and references therein).</P> false true _1_ 0 24 7 In stock false <P> <P>In order to address concerns about the promoter transcribing in the reverse direction, we have removed the -35 and -10 signals responsible for the promoter activity in the reverse direction. (<b><font color="red">More details needed here! DE, 2/24/03</font></b>)<P> Incompatible with host expressing cI repressor. true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation2025 1 OR2 range2025 1 1 17 annotation2022 1 -10 range2022 1 38 43 annotation7067 1 BBa_R0051 range7067 1 1 49 annotation2023 1 -35 range2023 1 15 20 annotation2024 1 OR1 range2024 1 25 41 BBa_K1444004 1 BBa_K1444004 Composite promoter and weak <i>B. subtilis </i> RBS - <i>C1-&#955;</i> 2014-10-07T11:00:00Z 2015-05-08T01:10:27Z B. subtilis A composite part consisting of the constitutive promoter Pveg (BBa_K823003), followed by the repressible promoter C1-lambda (BBa_R0051), and ending with and ending with the weak RBS from B. subtilis (BBa_K780002). This composite part was intended to control the expression of a downstream reporter, regulated by the expression of the pLacI repressor protein. The constitutive promoter Pveg allows reliable expression when the repressible promoter is not repressed. false false _1822_ 0 20978 9 It's complicated false No interference with endogenous cell signalling. false Dan Ziemianowicz component2404812 1 BBa_R0051 component2404816 1 BBa_K780002 component2404810 1 BBa_K823003 annotation2404816 1 BBa_K780002 range2404816 1 303 318 annotation2404810 1 BBa_K823003 range2404810 1 1 237 annotation2404812 1 BBa_R0051 range2404812 1 246 294 BBa_K823003 1 BBa_K823003 P_veg 2012-07-15T11:00:00Z 2015-05-08T01:13:29Z Bacillus subtilis Released HQ 2013 Pveg is a strong, constitutive promoter of Bacillus subtilis false false _1081_ 0 12081 9 In stock false no considerations false Korinna Kraft annotation2190180 1 promoter range2190180 1 1 237 BBa_K780002_sequence 1 agagaacaaggagggg BBa_K1444004_sequence 1 ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagttactagagtaacaccgtgcgtgttgactattttacctctggcggtgataatggttgctactagagagagaacaaggagggg BBa_K823003_sequence 1 ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagt BBa_R0051_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z