BBa_K1444005 1 BBa_K1444005 Composite promoter and consensus B. subtilis RBS - C2P22 2014-10-07T11:00:00Z 2015-05-08T01:10:27Z B. subtilis A composite part consisting of the constitutive promoter Pveg (BBa_K823003), followed by the repressible promoter C1P22(BBa_R0053), and ending with the consensus RBS from B. subtilis (BBa_K090505). This composite part was intended to control the expression of a downstream reporter, regulated by the expression of the C2P22 repressor protein. The constitutive promoter Pveg allows reliable expression when the repressible promoter is not repressed. false false _1822_ 0 20978 9 It's complicated false No interference with endogenous cell signalling. false Dan Ziemianowicz component2404844 1 BBa_R0053 component2404842 1 BBa_K823003 component2404851 1 BBa_K090505 annotation2404844 1 BBa_R0053 range2404844 1 246 299 annotation2404842 1 BBa_K823003 range2404842 1 1 237 annotation2404851 1 BBa_K090505 range2404851 1 308 318 BBa_R0053 1 cII p22 Promoter (p22 cII regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Bacteriophage p22. Released HQ 2013 The p22 cII regulatory region sequence is a 97 base-pair sequence with the standard BioBrick prefix and suffix sections on its ends. p22 cII repressor protein, BBa_C0053, binds to it.<br> This segment contains O-R1, O-R2, a fragment of O-R3, the -35 of P-RM, and P-R (-10 and -35 from Tom Knight)</p> false false _1_ 0 24 7 In stock false <P> <P><P> true Maia Mahoney annotation2038 1 -35 range2038 1 18 23 annotation2041 1 -35 range2041 1 8 13 annotation2035 1 OR3 range2035 1 1 3 annotation2042 1 -10 range2042 1 30 35 annotation7069 1 BBa_R0053 range7069 1 1 54 annotation2036 1 OR2 range2036 1 11 28 annotation2037 1 OR1 range2037 1 34 51 BBa_K090505 1 BBa_K090505 ''Bacillus subtilis'' consensus RBS 2008-10-27T12:00:00Z 2015-05-08T01:08:37Z This part was synthesized directly. This is the consensus RBS for Bacillus subtilis. false false _188_ 0 3501 9 Not in stock false The part must be 8 nucleotides away from the first methionine of the coding sequence, and so we added 'TGT' downstream of the actual binding sequence: AAAGGAGG. This, combined with the truncated non-CDS BioBrick prefix scar, gives exactly 8 'spacer bases' between the 3' end of the RBS and the start of the coding sequence. false Daniel Goodman annotation1992802 1 B. subtilis consensus RBS range1992802 1 1 8 BBa_K823003 1 BBa_K823003 P_veg 2012-07-15T11:00:00Z 2015-05-08T01:13:29Z Bacillus subtilis Released HQ 2013 Pveg is a strong, constitutive promoter of Bacillus subtilis false false _1081_ 0 12081 9 In stock false no considerations false Korinna Kraft annotation2190180 1 promoter range2190180 1 1 237 BBa_R0053_sequence 1 aataaacttgactaaagattcctttagtagataatttaagtgttctttaatttc BBa_K823003_sequence 1 ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagt BBa_K090505_sequence 1 aaaggaggtgt BBa_K1444005_sequence 1 ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagttactagagaataaacttgactaaagattcctttagtagataatttaagtgttctttaatttctactagagaaaggaggtgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z