BBa_K823003 1 BBa_K823003 P<sub>veg</sub> 2012-07-15T11:00:00Z 2015-05-08T01:13:29Z Bacillus subtilis Released HQ 2013 Pveg is a strong, constitutive promoter of Bacillus subtilis false false _1081_ 0 12081 9 In stock false no considerations false Korinna Kraft annotation2190180 1 promoter range2190180 1 1 237 BBa_K090505 1 BBa_K090505 ''Bacillus subtilis'' consensus RBS 2008-10-27T12:00:00Z 2015-05-08T01:08:37Z This part was synthesized directly. This is the consensus RBS for Bacillus subtilis. false false _188_ 0 3501 9 Not in stock false The part must be 8 nucleotides away from the first methionine of the coding sequence, and so we added 'TGT' downstream of the actual binding sequence: AAAGGAGG. This, combined with the truncated non-CDS BioBrick prefix scar, gives exactly 8 'spacer bases' between the 3' end of the RBS and the start of the coding sequence. false Daniel Goodman annotation1992802 1 B. subtilis consensus RBS range1992802 1 1 8 BBa_K1444010 1 BBa_K1444010 Composite promoter and weak B. subtilis RBS - C1-434 2014-10-07T11:00:00Z 2015-05-08T01:10:27Z B. subtilis A composite part consisting of the constitutive promoter Pveg (BBa_K823003), followed by the copies of the repressible promoter C1-434 (BBa_R0052), and ending with the weak RBS from B. subtilis (BBa_K780002). This composite part was intended to control the expression of a downstream reporter, regulated by the expression of the pLacI repressor protein. The constitutive promoter Pveg allows reliable expression when the repressible promoter is not repressed. false false _1822_ 0 20978 9 It's complicated false No interference with endogenous cell signalling. false Dan Ziemianowicz component2427610 1 BBa_R0052 component2427607 1 BBa_K823003 component2427617 1 BBa_K090505 annotation2427617 1 BBa_K090505 range2427617 1 300 310 annotation2427607 1 BBa_K823003 range2427607 1 1 237 annotation2427610 1 BBa_R0052 range2427610 1 246 291 BBa_R0052 1 cI 434 Promoter (434 cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Bacteriophage 434 right operator Released HQ 2013 The 434 cI regulatory region sequence is a 89 base-pair sequence with the standard BioBrick prefix and suffix sections on its ends. 434 cI repressor protein, <bb_part>BBa_C0052<bb_part>, binds to it.<br> This segment contains O-R1, O-R2, P-R, and P-RM -35.</p> false false _1_ 0 24 7 In stock false <P> <P><P> true Maia Mahoney annotation2031 1 -35 range2031 1 2 7 annotation2030 1 -10 range2030 1 24 29 annotation7068 1 BBa_R0052 range7068 1 1 46 annotation2032 1 start range2032 1 35 37 annotation2028 1 OR1 range2028 1 30 43 annotation2026 1 OR2 range2026 1 1 43 annotation2029 1 -35 range2029 1 1 6 annotation2027 1 OR2 range2027 1 8 21 BBa_K823003_sequence 1 ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagt BBa_R0052_sequence 1 ttgacaaacaagatacattgtatgaaaatacaagaaagtttgttga BBa_K1444010_sequence 1 ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagttactagagttgacaaacaagatacattgtatgaaaatacaagaaagtttgttgatactagagaaaggaggtgt BBa_K090505_sequence 1 aaaggaggtgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z