BBa_K823003 1 BBa_K823003 P_veg 2012-07-15T11:00:00Z 2015-05-08T01:13:29Z Bacillus subtilis Released HQ 2013 Pveg is a strong, constitutive promoter of Bacillus subtilis false false _1081_ 0 12081 9 In stock false no considerations false Korinna Kraft annotation2190180 1 promoter range2190180 1 1 237 BBa_K090505 1 BBa_K090505 ''Bacillus subtilis'' consensus RBS 2008-10-27T12:00:00Z 2015-05-08T01:08:37Z This part was synthesized directly. This is the consensus RBS for Bacillus subtilis. false false _188_ 0 3501 9 Not in stock false The part must be 8 nucleotides away from the first methionine of the coding sequence, and so we added 'TGT' downstream of the actual binding sequence: AAAGGAGG. This, combined with the truncated non-CDS BioBrick prefix scar, gives exactly 8 'spacer bases' between the 3' end of the RBS and the start of the coding sequence. false Daniel Goodman annotation1992802 1 B. subtilis consensus RBS range1992802 1 1 8 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986785 1 -35 range1986785 1 20 25 annotation1986784 1 BBa_R0040 range1986784 1 1 54 BBa_K1444011 1 BBa_K1444011 Composite promoter and consensus B. subtilis RBS - pTetR 2014-10-07T11:00:00Z 2015-05-08T01:10:27Z B. subtilis A composite part consisting of the constitutive promoter Pveg (BBa_K823003), followed by the repressible promoter pTetR (BBa_R0040), and ending with the consensus RBS from B. subtilis (BBa_K090505). This composite part was intended to control the expression of a downstream reporter, regulated by the expression of the pTetR repressor protein. The constitutive promoter Pveg allows reliable expression when the repressible promoter is not repressed. false false _1822_ 0 20978 9 It's complicated false No interference with endogenous cell signalling. false Dan Ziemianowicz component2405260 1 BBa_K090505 component2405253 1 BBa_K823003 component2405254 1 BBa_R0040 annotation2405253 1 BBa_K823003 range2405253 1 1 237 annotation2405260 1 BBa_K090505 range2405260 1 308 318 annotation2405254 1 BBa_R0040 range2405254 1 246 299 BBa_K823003_sequence 1 ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagt BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K1444011_sequence 1 ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagttactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaaggaggtgt BBa_K090505_sequence 1 aaaggaggtgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z