BBa_K823003 1 BBa_K823003 P_veg 2012-07-15T11:00:00Z 2015-05-08T01:13:29Z Bacillus subtilis Released HQ 2013 Pveg is a strong, constitutive promoter of Bacillus subtilis false false _1081_ 0 12081 9 In stock false no considerations false Korinna Kraft annotation2190180 1 promoter range2190180 1 1 237 BBa_K1444016 1 BBa_K1444016 Composite promoter and consensus B. subtilis RBS - pLacI 2014-10-07T11:00:00Z 2015-05-08T01:10:27Z B. subtilis A composite part consisting of the constitutive promoter Pveg (BBa_K823003), followed by three copies of the repressible promoter pLacI (BBa_R0010), and ending with the consensus RBS from B. subtilis (BBa_K090505). This composite part was intended to control the expression of a downstream reporter, regulated by the expression of the pLacI repressor protein. The constitutive promoter Pveg allows reliable expression when the repressible promoter is not repressed. The triplicate repressible promoter allows for stronger repression. false false _1822_ 0 20978 9 It's complicated false No interference with endogenous cell signalling. false Dan Ziemianowicz component2405411 1 BBa_R0010 component2405404 1 BBa_R0010 component2405396 1 BBa_K823003 component2405397 1 BBa_R0010 component2405419 1 BBa_K090505 annotation2405411 1 BBa_R0010 range2405411 1 662 861 annotation2405396 1 BBa_K823003 range2405396 1 1 237 annotation2405404 1 BBa_R0010 range2405404 1 454 653 annotation2405397 1 BBa_R0010 range2405397 1 246 445 annotation2405419 1 BBa_K090505 range2405419 1 870 880 BBa_K090505 1 BBa_K090505 ''Bacillus subtilis'' consensus RBS 2008-10-27T12:00:00Z 2015-05-08T01:08:37Z This part was synthesized directly. This is the consensus RBS for Bacillus subtilis. false false _188_ 0 3501 9 Not in stock false The part must be 8 nucleotides away from the first methionine of the coding sequence, and so we added 'TGT' downstream of the actual binding sequence: AAAGGAGG. This, combined with the truncated non-CDS BioBrick prefix scar, gives exactly 8 'spacer bases' between the 3' end of the RBS and the start of the coding sequence. false Daniel Goodman annotation1992802 1 B. subtilis consensus RBS range1992802 1 1 8 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961227 1 start range1961227 1 173 173 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_K1444016_sequence 1 ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagttactagagcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaaggaggtgt BBa_K823003_sequence 1 ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagt BBa_K090505_sequence 1 aaaggaggtgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z