BBa_K823003 1 BBa_K823003 P<sub>veg</sub> 2012-07-15T11:00:00Z 2015-05-08T01:13:29Z Bacillus subtilis Released HQ 2013 Pveg is a strong, constitutive promoter of Bacillus subtilis false false _1081_ 0 12081 9 In stock false no considerations false Korinna Kraft annotation2190180 1 promoter range2190180 1 1 237 BBa_K780002 1 R37 Strong RBS for Bacillus Subtilis 2012-09-25T11:00:00Z 2015-05-08T01:13:18Z 'host-takover module' from B.subtilis Bacteriophage SPO1 Strong RBS for Bacillus Subtilis false false _1034_ 0 10113 9 It's complicated false - false Krzysztof Szczepaniak BBa_K1444024 1 BBa_K1444024 Composite promoter and weak B.subtilis RBS - C1-434 x3 2014-10-16T11:00:00Z 2015-05-08T01:10:27Z B. subtilis A composite part consisting of the constitutive promoter Pveg (BBa_K823003), followed by three copies of the repressible promoter C1-434 (BBa_R0052), and ending with the weak RBS from B. subtilis (BBa_K780002). This composite part was intended to control the expression of a downstream reporter, regulated by the expression of the pLacI repressor protein. The constitutive promoter Pveg allows reliable expression when the repressible promoter is not repressed. The triplicate repressible promoter allows for stronger repression. false false _1822_ 0 20978 9 Not in stock false No interference with endogenous cell signalling. false Dan Ziemianowicz component2427313 1 BBa_R0052 component2427297 1 BBa_R0052 component2427319 1 BBa_K780002 component2427294 1 BBa_K823003 component2427305 1 BBa_R0052 annotation2427313 1 BBa_R0052 range2427313 1 354 399 annotation2427319 1 BBa_K780002 range2427319 1 408 423 annotation2427297 1 BBa_R0052 range2427297 1 246 291 annotation2427294 1 BBa_K823003 range2427294 1 1 237 annotation2427305 1 BBa_R0052 range2427305 1 300 345 BBa_R0052 1 cI 434 Promoter (434 cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Bacteriophage 434 right operator Released HQ 2013 The 434 cI regulatory region sequence is a 89 base-pair sequence with the standard BioBrick prefix and suffix sections on its ends. 434 cI repressor protein, <bb_part>BBa_C0052<bb_part>, binds to it.<br> This segment contains O-R1, O-R2, P-R, and P-RM -35.</p> false false _1_ 0 24 7 In stock false <P> <P><P> true Maia Mahoney annotation2031 1 -35 range2031 1 2 7 annotation2030 1 -10 range2030 1 24 29 annotation7068 1 BBa_R0052 range7068 1 1 46 annotation2032 1 start range2032 1 35 37 annotation2028 1 OR1 range2028 1 30 43 annotation2026 1 OR2 range2026 1 1 43 annotation2029 1 -35 range2029 1 1 6 annotation2027 1 OR2 range2027 1 8 21 BBa_K780002_sequence 1 agagaacaaggagggg BBa_K823003_sequence 1 ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagt BBa_R0052_sequence 1 ttgacaaacaagatacattgtatgaaaatacaagaaagtttgttga BBa_K1444024_sequence 1 ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagttactagagttgacaaacaagatacattgtatgaaaatacaagaaagtttgttgatactagagttgacaaacaagatacattgtatgaaaatacaagaaagtttgttgatactagagttgacaaacaagatacattgtatgaaaatacaagaaagtttgttgatactagagagagaacaaggagggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z